Transcript Name :
Pytul_DAOMBR144PYU1_G000537
Orientation:
(+)
Number of Exons:
2
Description :
Similar to Ano8: Anoctamin-8 (Mus musculus)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
345-350
463-490
702-734
795-844
1-321
371-439
514-678
758-771
322-344
351-370
440-462
491-513
679-701
735-757
772-794
NN-scoreoddsWeighted Score
0.5442.2010.004
PositionContextScore
375LWRRKQR|EV0.55
434DFPRHKR|LF0.563
611DGRRRRR|SS0.659
659VQERIKR|VL0.562
TypeScore
endoplasmic reticulum444
GO
*** None ***
*** None ***
*** None ***
Sequence
        2637 bases(100 bases per row)
ATGCCGAGCACCGTGCACCGCACGCCGATTCTGCAGCGCATCCTGAACTCCACGGGACGTGCGCCGCTGATGGACCATCTCAAGAAGCGACATGAGCAGC
TCACGGACGACGATGACTCGAGTGACGAGGATGACGACACTGCGCACTCGATTCGGCGTCGAGTATCGCGGATTTTCCTCCAGCGGTTCCTGAAAAAGCA
CGACGTCGCATGCGAAGCCGACTTCTGCCTGTACTTTGAGATCCCGCAGCGCGACGCGATCGCCGACAGTGAGCGCTCGGATATGCCCGTAGACGATCAG
GAAAAACGGTTTTCGCGGCAGAGAACGTCATCATCGTCGTCGTCGAGCAGCAAAGACGAATCGGATGTGCACACAATCATCGACATCACCGCGATGATCC
TTCGAGACGCAGGGTGCCAGGTCATCCTGTATCCACTGCAGCATGCCGACTCGGAAGCACTGCCCGAGTCCAAGCAGCCAGCGCAGGCTTACGTCATGAC
TGTCGGGTACGAAAAGTCGAGTGACTCCAGTACAAATACAGCGATCCCAGAAGATCAGGAGGCTCCTCCACCACCCTCAAACTCACTGCAGCCATCTCTG
CTGCATGTGCTGCCTCGTCATCACCAGAAGCTTCCGTCCTGGGTGACGCTACACCCGGCGTACACGAAGCACATCTTGCCGCTGACAGGCTATGCGCAAA
CCCAGCAGCTCACGAAGCTCATTCTGAAGGAGTGTCGTACGGACCACAATCTATACATGGCGAACGGCGTGCTCGTGTTTGAAGCCGAGACGAAACTGCT
GACCCAACTCGCGCGGCGCGACGACCTCACGATTCAGTTATACCCGCTGCATCGCGACGATTTCCGAGACGCGATGATCAAGAAATGGACCAAGCACGCG
ACGTACGCGCCACCGCTGTACGACATTTACCAGTACTACGGGCCAAAGATCGCGATGTACTTTGCGTGGCTCGACTTCTACACCAAGATGCTGATCGTTC
CAAGTCTCTGCGGCGTGTGTCTGTACGTGCTCGGCCAGTTCAATGCACAGAGTTACAGCTTACTGTCGTTCTTGCTCGCGATTGGCACGTCCGTGTTTGT
GGATCTCTGGCGGCGCAAGCAGCGCGAAGTCGAGTACACGTGGAAATACCAGGCGCTCACGGAGCCGAGCGGGGCTTCGAGCAGTAGCGTACCTGGACTT
GTTGGACTCGACTACATCGAGACGCGGCCCGAGTTCAAAGGCGAATGGACAAATGACCCCGTTACGCGCGAGTACATTTACGATTTCCCGCGGCACAAAC
GGTTGTTTCGCCAGTCGCTCGCGATCCCTCTGCTGCTCTCCATGTGCTGCGTCGTCGGCGGCTACGTCGTGGCGCTCAACATGCTCTCCGACCATCTCCG
ATCGCGCTACCGTGTCTGCTACATCAAACACGGCAACGCGCACCGCCACAATCATGAGACCGACGCGCCGAGTCCTGCCTTCTGCGCGTTCATCTCACAC
GGACCGGGCGTGTTGAACGCGCTGATCATCTATGTCATGGATCTGCTGTACCAGCAACTCGCGTGGAAGCTCAACGAGTTTGAAAACTACCGCACGGCCG
AGGAGTTTGAGGACAACCTCGTGCTCAAGCGCATGCCGTTCCATTTCGTCAACAGCAACGCGTCGCTCTGGTTCCTCGCGTTTTACGTACAAAACCTCGA
GCGCGTGCGCGAGCGGCTCTGGATCCTCATGGTCGGCATGCAGCTTCTCGACAACTTCAAGGAGGTCGGGCTCCCGTTTGTCGTCTCGCTCACCGGTGAA
TTCTTGACGGCGGACGGACGACGACGACGACGCAGTAGTCACCACAGCAGCGCACTCGAAGGCGACCTACAATGGAGCACGTCTCTCTCGGGCACACCCA
GTTTCGTACGCTCGCTACCGCCAGAGCTCAAGCGCCAGCACACGTCGCTCGCGTCGGTGCAGGAGCGCATCAAGCGCGTGCTGATGCAGAAGCGCCAGGC
GCAATACAAAGACACGTTCGCCGACTACAAGGAGATGATGATCCAGTACGGGTACGTCGCGCTGTACAGTCCGATCTTCCCGCTCGCGCCCGTGTTTGCG
TGGATGAACAACGTGATCGAGAGCCGCTCGGACTTCCTCAAGCTCGTCAACACGCACAGCTACCAGCGCCCGATGGTGCAGCACACGCGCGGCATCGGTG
TGTGGGAGAACGTGCTCGTGTCGTTCTCGGTGCTCGCGGTGATCATCAATTTTGCGCTCGTGTGGACGTACGAACTCAACGACCTGCTCCCGTCCTGGTC
CGAGCTGCATCGCTTCATGTTCATCGTTGTAAGTACTGCGCGTGCGCTTTGTGTGTAGCTCTTTAGCATATGTTGTTTCTCATTTCTCTTTGGTTGCCCT
GATTATTTTTGCGTGATATGATGATAACAGGGCTGCGAGCATTTGGTGTTCCTGGTCAAAGTGCTGCTGAACTGGGCTGCGCCCGATGTCCCGACGTGGA
TCCAGAACGAGAAGCGCATCGCCGCGCTGCACCGGACGCACGAGGAGGCCTATGCGACGCAGCCCATGGCCAAGGACCATGACGCGCAGAGCAGCAGCAG
CAGCGAGCAGAACAAGCATGCGAGCGATAGCGACTAG