Transcript Name :
Pytul_DAOMBR144PYU1_G000551
Orientation:
(-)
Number of Exons:
4
Description :
Similar to eny2: Enhancer of yellow 2 transcription factor homolog (Xenopus tropicalis)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-102
*** None ***
PositionContextScore
11FADRKRR|DE0.633
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        775 bases(100 bases per row)
GTTGCGCCAAAGAGCCAAACGGAAACACCATCATGGAAGAGTGCGTGAATGAACCATCCTCTCTTTCTCTCTATGTTGTTTACAAGGAGCACATGCATGC
ATGCATTGTATATGCCCCCCACTCTGTTGCTCATACTACTCCTCTGTATGTGCTTGCACGCGCCTCTCTCTCTCTCTGTAGATCATTTGCCGACCGCAAG
CGCCGCGACGAGCAGGTGAAAGAGCGCATCAGCCAGAAACTGGTCGAAAGCGGCGAGAAAGAGCGTCTGAAGGAGCTTTTGCGCCACAAGCTCATCGAGT
GCGGGTGGCGCGACGAGATGAAGCAGCACTGCAAAGGTCTGCGCTTCATTATTTAGAATAGGATACAAAACGGAGAGAGTGTGTGTGTGTGCACTGAGTG
CGGTGAGTTTATTGTGTATAGAGGTGATCCGGAACAAAGGCATCGACCAAGTGACTGTGGAGGATCTTGTGGAGGAGATCACGCCGAGAGGAAGAGGTAC
GCATCCACCATTATAAATTGCTGCTTTGTTGTGATTCCGTTGATTCAGATGCTTTGTATATTGATAAAGTGTCGGTACCGGAATCCGTGAAGACCGACAT
ACTCGAGAAAATCAAAGCGTTTATCGAGAAGTCAGCGTAATAGCCATCCAGGATGATAGAGAGCTGCAGAGAGACTCGCAATGGAGCGAATGAATGAGTG
CACAATCTGCGCCTCAATGCTCGTCATATAAGACACGAACAATTCGATAATTTATAAAACCATCCATTCCGACGA