Transcript Name :
Pytul_DAOMBR144PYU1_G000563
Orientation:
(-)
Number of Exons:
6
Description :
Similar to taf11: Transcription initiation factor TFIID subunit 11 (Dictyostelium discoideum)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-333
NN-scoreoddsWeighted Score
0.6822.1560.004
PositionContextScore
273ESLRKKR|KL0.589
TypeScore
nuclear783
GO
*** None ***
*** None ***
*** None ***
Sequence
        1610 bases(100 bases per row)
ATGCCGAGCGTGCGCGAAGACGTCGAAGTGTTCCTCCACGAGCACCGCTTCCTGGTCACGAAGCTGCTGGAGTCGCTCAGCACCGCGTCGCTGTACGTGT
CCTCGCCGCCTACGCTGTCGCTTCTTGTGTTTCTTGTAGCGTTACGCAGACGAGCTAACGATCGCTGAGTCTGCCATGAACTAATGGCGACCACATGCTT
TTCTTTTTTTAATCTGCAGGCCGCCGTCGACGATCACTGCGACGCGATTGCGCACTGTGAACGAGACGTTCAACAAAGCGCTGGAGAAAGATCGCGAATT
GCTCGCGGCCGTGAAGAAGTGTACGTTGCATTTGGGTGATTATGTGAGTGTAGATGGTTGTATTGTGTAACCATTTTTTCGCTCGATGTTAGTGGCCCGC
CACCAAGTCGCGCAGAAAGAACTCGCGAGCATTCAAGACGAGATTCAGAAAAAGAAGCAGAAAGTAGTTCGTTATGCCGCGCAGCTGCGACGGTCCCAAG
AGGTTTGTTTGTTTGGCTGGGTCGTGATGTTGAAGCTTGGTATCCTGGAGGAAACTGACGTGCCGAACCGTGTTGACATCGCAGGACATCGCTAATGTGC
TAAAGAAACACCAGACTATTCTCCAGAATGCCAAACAGAAAACCAAAGGTAGTGTTTCCTATCTGAAGAGGGAATGATTTGTTTCTTGAAAAAAGAGGAT
ATGCTAATGTGTGGTTGGTGTTGTGAAACACAACAGTTGTACTGGATCCGCAGGACATTGTCGCGTACGCGCATCGTATCGCGGGGACAACGTCTGCGCC
AAAAGAGTGGCGTCCTGGCGTACGTTGTGTATTTCGCTTTTCATCGTTAGCTATAACGATCTCTTATCATCTTTCCTTTTTCTTCCCTCTGTAGTTCCCT
ATGTTTGGCTTCATGCCACCGGCACCGCAACCACATATGATGCGCGCAGGTGTACTCAGTCGTGGCATCGTCGCTGAGATTGTGACGCAGGAGCCTGAGA
AGTACTCGTCGACGTCGAGCAAAGTCAAGAAAGACGAGGATCTCGACAAGCTCAACATCCCTATTGGATTGGGCGCGAGCGATGCGCAAATTAGAAAACA
AATGCCGGCAGGCTGGAATCCGGGCGACCCTGTGGATCTTCCTCTGGATGCATTGCTCCATTACATGGGGCGAAGCTTTTTCACGGTACTTATTGCTCGG
GCAATGCATCGTTATCCTTGGCCGTGAAGAGGATGCTTACCCTTTTTCGTGATGTATTCTTTCGGTAGGAACAAGGGATTACGTTGCCTGAGTCCTGGAA
AACAGGAGACCCACTTCCACCTGATGCGATGGAGATTTTGCGAAAGAAGTTTAAACTTCCAGAAAAGCGCGCACCATTGTACGAGGACGAAGTTGTCGAC
GACGTGGAAAGCCTGCGCAAGAAACGCAAGCTGGATTCCGAGGACGAAAGCGGTACTGCTACGGGTAATGAAACAGGCTCCGGGAAAGAGGATGGTGAGA
GTGACAGCGACAGCGATAGCAGTGACAGCGATTCCGATAAGGAAACGACCCAGAAGATCTCGCTCAGTCTTTCCTCGGACGATGACAGCGATGATGACGA
TAGTGACTGA