Transcript Name :
Pytul_DAOMBR144PYU1_G000546
Orientation:
(-)
Number of Exons:
2
Description :
Similar to Nop14: Nucleolar protein 14 (Mus musculus)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-914
*** None ***
PositionContextScore
284LEFRPTR|SN0.515
342EKKRVAR|MK0.501
*** None ***
GO
*** None ***
*** None ***
Cluster Id
1870
Sequence
        2829 bases(100 bases per row)
ATGGTGTTTAAGAAGAAGGGCGGGAACTTTAAGGTCAGCGGCGGTGGCGGCGGCGGCGGTCGTGGCGGTGGCAGTCATGGCGGTGGCAGTCATGGCGGCG
GTCGTGGCGGTGGCCGCGGATCCGCGCAGTCGCAGAAGAACGCCGGCGCCAAAGTGGTGCGCACGTCGTCGTCGACGGGCCGCAATCCATTCGATGTGCG
CGGCAACGCCAAGGCCAAGTACGAGGTGATCGGTAAGCGCATCAAGGGTCAGGGCCGCAATGTGGCCGAGGCGCGCGCTGAGGCCGAGACGAAGCGCAAG
AAGTCGCTCGGCGCGCAGTTCCAGGCGCGCAACAAGGCCAACTCGTTCAAGGACCGCCGTCTCGGTGAGCAGGACCCGACGATGTCGCTCGAAGACAAGA
TGATTGCGCGTTTCCAGACCGAGCGCAAGCGCAAGCTGCGCAACGCGAGTGCGTTCGCTCTTCACGACTCGGATGACGAAGACGACGACGAGCTCTTTTT
GACGCACGGCGGCGCCAAGATCGACGATTACGACAACCTGAACGCCGACGCCGCGTTCGAGCAGGACGCCGAGGATGACGACCACGACCGCGAGATGGAC
AAGGAGATTGTCAACAAGCTGCACTTTGGCGGCGGCGTCGGAGGCTCCACGGCGGGCCACTACGGTCCAGCGGCTCCTGAGGAGGATGGTCGCAAAAAGT
CGCACAAGGAGATCATGCAGGAGGTGATGCTCAAGGCCAAGATGTTCAAGGCCGAGCGCCAGAAGAACAAGTCGGCGCAGGAAGACGCGACGGACAATTT
GGATGAGGGTTTCAATGACATCCGCGCGCTGCTCGAGTTCCGCCCGACGCGATCGAATGGCAAGGAGATCCAGGAAAAGACGCCGATGGACGATTTCGAC
AAGCTCACGCGCGAGTTTGCGTTCGAAGCCAAGGCCAAGGCCACGGAGCGCCGCATGTCCCCCGAGGAAACCGCGGCCAAGGAGCGCGATCGTCTCGCGG
AGTTGGAGAAGAAGCGTGTGGCGCGCATGAAGGGCGATGACGACGACGACAGTGACGATGAGACCACTGGAAAGAAGGGAAAGAAGGGAAAGAAGGGCAA
AGACGGCAAGAAGAAGCAGAAGACACCGCAGCAGATCGTGATGCCGCCAACGGACGACGATCTGTCCGCGGACTATGACCTGGACTCGCGCTTCAATGCC
GCTGAGCAGGATGGCGAGGACGAGGAAGGCGAAGGAATGGACGAAGATGAGGAAGAGGATGAAGAAGAAGAAGAGGAGGAAGAGGATTCGGAAGCGGAGT
CTAACGATGACGACAATGAAGAAGAAGCCACGGCGGAGGCGGAGCAAGACGAAGACGCAGAGAAAGAAGACGCTGACGAAGATGAAGATGAAGACGAAGA
CGACGAAGAGAAGGAGCGAAAGCGCCAGGAAGCCGCCGAGGAGCTGCCGTTCGTGTTCCCGTGCCCAGAGAGCCCCGAGGAGCTCACGGCGCTGTTCAAG
AACCACGCCAAGCAGTCGGCCGCGAACCGCGCGCTGATCGTCGAGCGCATCATTACGTACTACTCGCCGCGTCTGAGCGTCGAAAATCAGTCCAAGATGA
AGAGCTTCTTTGCGATTTTGATCCGACAGTTCCTCAAGTACGCGAGCAAGTACGCGGTTCACCGCGAAGATGTAAGTCGTCTGTTTTTCTATGTGGCGTA
TATGTGGGGACGTTGCATGTATCTAACAATGTGCTTTTGCGTTGTGTGCTTGTAGCTTGACGGGTTAGCCAAGCATTTGTTTGCGCTCGCGCAGCAGTTG
AGCGACACGGCGGGCGTGATCGTGCGTGAACTTTTGATCAACCTCTTCAAGCGTCTGCACAGCACCAAGTCGCCGTCCAAGTGGCCGGAATTATCCGAGT
TGCTTCTCTTCAAGGCGCTAATCCAGATCTTCCCGACGTCGGATCTGCGCCACAATGTGATCTCCCCCATGGAGACGCTGCTGGGCGAGAGCCTCGTGAA
CGGTGCGCTCGAGAGTCGACAGGACGCCACGAGAGCGCTCTTCACGTGCACGCTGATGCTGCAGATCACCAAGGACAAGCAGCGCTTCACGCCCGAGGTG
CTCGTGTGCCTCAAGAAGCTTGTGCGCGTCTACTTGGTGGCGTCATCGTCGCTGCGAACGGAGTTGCAGGAGTGGATCGCCGCCGCCAACAAGGACGAGG
ACCTGACGCTCCCCAAGCTGGAGCTCGCGGCGGCGTCGTCGGTGTCGTCGGCTGCGATCCTGAACGGCTTGTTGGGCGTCGTCGACCTCGCGACGCAGCA
GTACGCGCACTTGGCGTCGTTCGACGAGCTCTTCCACCCGATCTACTTGCTTCTCCACGAGCTCACACGCTCGCTGTTTGACGGCAAGAGCACTCGGGTG
AACGAGACGATCGCGCGACTCGCAGACCAATTGGAGAAGTGCTGGGCCGCGCGCACGCCGTTGCGGCTGCAGAGCTTCGCGCCGGCGTTGCTGCCGACGT
TCACGCCAAAGTTCGACGAGAACTACACGCTGCGGAAAGACAAGGGCGCGGACCGCGACAAGGCCAAGCTCAAGCAGCTGCAGCGCCAGGTCAAGCGTGC
GCGCAAGGGCGCCGCGCGCGAACTGCGCCGCGATGCCGAGTTCCTGGCGCGCGAGAAGCAGCAGGAGGAGAACGCGCGTCTGGAGAGCAAGCGCGAGAAG
CAGAAGGAGATCTGGCGATGGCTCGAGGAGCAGAACGCGACGTTCAACGAGCAGGTCAAGAAGGGTGGCAACATGCTTAAGGGCGGCGGCTCAGGCCCGG
CCAAGAAGCGACGCGTTAGTAAGAAATAG