Transcript Name :
Pytul_DAOMBR144PYU1_G000532
Orientation:
(-)
Number of Exons:
3
Description :
Similar to mcm5-B: DNA replication licensing factor mcm5-B (Xenopus laevis)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-742
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K02209
K02209
K02209
K02209
Cluster Id
2216
Sequence
        2402 bases(100 bases per row)
ATGGACTGGGACGTCGGACGCGTGTCGTCCATGGGCATGGAGAGTGCCTCGGCCGTGGCGGCGCGCGATGCGCAGGACACATCGCCGATCGCGATCCAGA
AGCGGCTGCACGAGTTCCTGCGCAACTTCCGCGTCGGCCCGATCTTCTTCTACCGCGAGCAGCTCATCGCCAACTACCGCCGCAACAACTACTTTTTCAC
GATGAACCTGAGCCACTTGGCAACCTACGACCAGTTCCTACAGGACCTGATCCTCAAGAACCCCAAGGAGTATCTGCCGCTGCTGGAGAATGCCGCCAAG
GAGATGCTCGCGTACCTGCTCGTGCTTAACCGGAGCGAGCAGACGACGACGATGGACGGCGCGATCGGAAACGAGTCGATGAACGTCAAGAACCTGCCGG
ACATCCAGGCGGTGATCACGAGCGACCAGGCGCCAACGGCGTTGCGCGCCGTGCACGCGCAGGAGATCAACCGACTCGTCAAGGTGCCGGGTATTGTGAT
CAGCGCCACGCGCGTGCGCACTAAGTGCGTCTCGGCGACGCTGCGCTGCAAGAACTGCGGCAACTCGAAGCGCGTCGCGGTATCGGGCATGGGCGGCATC
AACATCCCGCGCATCTGCGACCGCAACCGCGAAGAAGAGCCGAGCAGCGAGTTGTGTCCAAAGGATTCGTATATCGTGCTCCCGGATCGCTGTGACTACG
TGGACCAGCAGACGTTAAAGCTGCAAGAGAACCCCGAGGTCGTCCCGACGGGTGAGATGCCGCGGAATCTCGCGCTCATCGCGGATCGTCACCTCGTGGA
CAGAGCGTCGCCAGGCACAAGAGTGTCGGTCGTGGGCATCACGTCCGTGGTCAATGCTGGCGCCAAGCAGATCGGCGCTGTCGCCATTCGAACGCTGTAT
CTGCGTGTTGTTGGCATCGAGGTACACTAACTACAGATTTGTATGTGGATGTGGGATTGCATGCCGTATAGTAATGAGCCTTTGCTCCAATATGTGTACA
ACAGATTGACGAAGAAGGCGCGGGACGGGCAAAGGCGACGTTCTCGCCGGCCGAAGAAGAGAAATTTCACGAAATGGCGCGGGACCCCGACCTGTACGAC
AAGCTCTCGTCAAGCATTGCGCCGTCGATCTACGGCGACTACACGACCAACATCAAGAAAGCGATCGCGTGTCTGCTCGTCGGCGGTTCACGGAAGCGAC
TGCCCGATGGAATGATCGTATGTTTTGAGGCAATGACCTTTCATGTGGCTACGCGATCTCACCTTTCGTCGTGTGTGTATATGCGGCGGTGTATGTGTAA
CAAATAGCTGCGTGGAGACATCAACGTGCTCCTGCTTGGCGATCCGTCGACGGCCAAGAGCCAATTCCTCAAGTTTGTCGAGAAAGTGGCGCCTGTCGGC
GTGTACACATCGGGTAAAGGCAGCAGCGCGGCGGGTCTCACGGCGTCGGTGATCAAGGACTCCAAGGGCGAGTTCTACCTCGAAGGTGGTGCGATGGTGC
TCGCCGATGGCGGCGTCGTGTGCATCGACGAGTTTGACAAGATGCGCGAGTCCGACCGCGTGGCGATCCACGAAGCCATGGAGCAGCAGACGATCTCGAT
CGCCAAGGCTGGCATCACGACGATCCTCAACTCGCGCGCGTCCGTGCTCGCGGCCGCGAACCCGGTCTTCGGCCGCTACGACGACATGCGCAGCGCGTCG
GAGAACATCGACCTCATGAGCACTATTCTGTCGCGTTTCGACATGATCTTCATCGTGCGCGATATCCAGGACGACACGCGCGATCGACAGATGGCGGCCC
ACGTCGTGCGCATTCACACTAACTCGCTCGGCACCGTGAACGGCGCCAAGTCCGCGGTCGAAGAGAAAACGGGCGAGTACGAGCCGTGGCTCATGAAGAA
GTTCATCACGTACTGCCGCACGCGGTGCGCGCCGCGGCTTTCCGTGCACGCAGCGCAAGCGCTGCAAGATTTCTACGTCGGCGTGCGCGACGATGTGCGC
AAGAACCAGGGCGGCGAGACGACGATCCCCGTGACCGTGCGGCAGCTCGAGGCGTTGGTGCGCATCTCCGAGTCGCTCGCCAAGATGAAGCTGCAGAACG
AGGCCACGATCGACCACGTGCGCGAGGCCGTGCGCCTCTTCTCGGTCTCGACCATGAACGCGGCCAAGGACGGCGGCACGCAGGGGCTCTTCGGCGGCTT
CCACGAGAAGGCGCAGGAGGTGGAGCACAGCATCAACCGCACGCTGCGCATCGGCATGCGCGTGGAGACGGCGGCGCTCTACAGCCGCCTCGAGGCGCAG
GGCTACAACCCGAACGCCATCCAGCGCGCGATCCGTGCCATGGTCCAGAAGGGCTCCTTGCGCCAGTTGAACCAGTACAAGTTTGTGTCGCGTGTTAAAT
AG