Transcript Name :
Pytul_DAOMBR144PYU1_G000549
Orientation:
(-)
Number of Exons:
1
Description :
Protein of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-20
78-85
146-151
204-266
41-54
109-122
172-180
21-40
55-77
86-108
123-145
152-171
181-203
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        801 bases(100 bases per row)
ATGATTCGCGAAGAAGAAGCTGCTGGTGACTCGCGAGATTCGGCGGACAGTGCTGGTACCTTGTTCAAATTTGTACTGAGCATCTTTTTGATGCTTGTGT
CGGGTCTCTTCCTGGGTGCATTGAACATGTACATGTCGCAAAAGTTTAGCACGATCGAGAATGCGCAGTACATGTTTGTGAACTGCGTCGCGCTGCAGTT
CCTCGGCGCGTTGTTCTCGTTCTTCTTCATGGACCGCGTGGATCACCGACGGATCCTGTTCTGCACGTTACTGCCGATCGCCGCGCTTGTCGCGATCCTC
GGTGTGAACGTGAGCTCTAATGTCTGGACGGGCGACTCCGAGTACCTGATGCTGCGCATTGTGGGGCTGCTGCTGTACTTCTTCGCGGGCCTGGGTATCA
CGTCGGTGCTGTGGCTGTCGTGCGTGGGTTTTTTCCGCACCAAGGCGCGTGCGTTCTACACGAACCTGTTCTTTATGCTCTTCTTCTTGATCCCAGTGCT
GTCGCTGTTCATGCGCGTGAACACGTCGTACGCGAACAAGCAGTACATTTACCTGTACGGGCTTTCTGGGGCATGCTTCATCGTGCTGCTGCTGCTCTTT
GGCGTCGGCACACAGAAGAACGGCATGCTGTGCACGAAGACCGAGATGGAGGTCGAGCGCGCGCGCATCCGCCGCATGCGCCAATCGCGCCGCAGCGCTC
GCACCCCGGGCAGTGCACGCAGCCGCAACCTCAGCCGCTCCCGCGGCAAGTCGCACTCGAACTACCAAGTGTACGAGTCTCCAGCAGGCGGACTGCCGTA
A