Transcript Name :
Pytul_DAOMBR144PYU1_G000552
Orientation:
(+)
Number of Exons:
1
Description :
Similar to SPBC1711.05: LisH domain-containing protein C1711.05 (Schizosaccharomyces pombe)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1205
*** None ***
PositionContextScore
414TRDRDRR|GS0.712
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3618 bases(100 bases per row)
ATGCTCGACTTCCCGCTGCACGAGGGCTTCTTCCCACAGATCGCGTTGAGCGCGCAGGAGCTCAAGTACTACAAACGCCTGGGCAAGGAGCGCGTGGCGC
AGCTCATCCGCGTCATCGAAGACGCCGAGTGCGCGTACAAATGGACGGATGTCAAGGCGGTGGCCGCGGCCAAGCGCTATGGCACGAGCACTGGCGCCGC
GCCACAGTGCCAGAAGGCGCAGTTCCTCGACTTCCAGCCGACGAGCAAGGCCACGTACGCATCGACACTCCTCAAGGCGAGCGTGCAGCTCGCCGATGTC
AAACCGGACGAGATCCTGAGCGCCGTTGCGAAATGCAAGACCAAGGACTTCCGCAAGGTCATGAAGTACGTCCACGGCGACGCGTTCGTGGACGGTCGCA
CGCTGTTCACATTCCCGTCTTCAAACGCGCAACGGGTGCGACCCGCGTACAACTACCGTGCGATCAAGTGGCACGTGATGAAGCAGAATAAAAACGCACC
GAACGACCCAAAGAAGAAAACGAATTCGCTCGATTTTGCCTACTTGGAGTACGCCGGTAAGCGCCGCGCGCCGCCCGGATCCAGTGTCGTCGGCTTCTGC
ATCCAGGAATCGATCGCCCGCGAGCGCGAGATCCCGAGTCTCGAGAACTTTGGCGTCGCGCGCGGGTACCTGTCGCGCACGGGCGTCATCATCTCGCGAA
CGCACCAGGCGCATGTGTGGAAAGTGACGTCAATCTGCCAGATCGATGGCGACCTCAACCCGGTCGTGCGCGCCGCGCTCGAAGACGTAATGCAGGACCA
CGTGTGCCGCACAGTGCTGCGCGTCAAGGGGCTCGTGGACCGCCAGCGCGTGAGCAGCTTGCGCTTCGTCGAGCAGTGGCAGTGGGTGCCCAACTCGGAC
CGCAAGGCGTGCGCCGTGTGTCTGCGCGGGTTCTACTTCCACCGAAAACACCATTGCCGCACGTGCGGTGAGGTCGTGTGCTCGAGTTGCGCGCCATTGC
GCGAGCTGGAAGAGCCGATCTTTGACATCACGCAGTTGCGCGTGTGTTCGGGCTGTATGAGCAGCGCGAGCGCGAATTTCAACACAAACGTATCGGGCAC
GGCGGGCACATCGGCCAACCAAGCGTCGACAGCTTCGAACGGAGACACCGAGTCGTACATCCGCGGTCTGCGCAGTCCGCAGCACGACTCGTACGAGAAC
ATGATGTTCCAGATGCGCGAGACGCGCGACCGCGACCGACGTGGCAGCGACGCCGCGCAGCTCGTGCTGGAGAACAACAATGTGATGACGCCACCACCAT
TAGCAAAGGAGAAGCAGCAGCTCGACGACAGTAGCAGCAATGGGCATGCGCAAAACAGTCCGCTGGGCATAAAGCCACAGGAGAAATTGGACGCGCTCTC
GGACGTCGTGAGCCATATTCGGGAGATCCGAGACACGATCAACATTAGCATCTCCGAAGTCGATTATGCGAGCGGCCGTGGCGGCGAGGACGACGAGTAC
GATGACGAAGCAGACGACCATGATGATAACGACGAAGTCTACGACGATGTGCGCGCGCAGATGCTCAAGATCCGGGAGACCCTCGAGTCGTCGGTGCACA
ATTTCGACGCTGCGTTGGCGAATGCGACGCACGCGCCGTTGTATCCGCACAAGCGCGGCCACAGCGACAGGAGAAAGCAGCAACAACAATCACAGCACAA
TGGCAATGGCCATACCGTCGGGCTCACCACGAAATCGTCGGACGAGAGCAGTGGTCGCAGCAGTAGCGACGATAACGTGATGACCCCCGAGCAGTTTGCG
TCCGTGGCGCGGATCACGTTTGCAGCTGCGCGAGCGACCAAGCAGGCAGGCGAGGCGTTCCTCTCGTCGTGCGGCTCGGATGTCGGCCATCTGTCCGAGT
ACGACGACGAAGATGCAGCGTCGTCGGTCGGAGGCGGAAGAGTGAGGACGCCGTCGGAGGACAGCTTCGCCACCGGGTACAGCGACACGAGTCAGGATCC
GTACTCGTCGTCAAACTACGAGCGCCTCATGGGCTCCTACGACAGCGAGGACGAGGATGACGAGCGAGATGAACGTCCAGCCCCCCCTCCACAGCCGACA
CTGAAGCGCAAAAAATCGATCAACCCGCACCCGTCGTCGACGCGCCGCGTGAGTGAAATCTACCAGCTGGAGAAGAAAATCGCCGAGCTGCAGCGCAGTC
TTGAGCACGCGCAGCGGAAGCTCTCGGTGTTTGACACCGACGAGCCCGACCCGGAGCAGCCAAAGAGTGGCGGCGGCGGCGCGTTGGAGGTCGTGTACGA
AGAATCGGCGCAGGTCGAGATCGAGAGCGTGTTTGAAGTGTTTGGTAACCGAAGCGACACGAGCAGCGCGGAAGGTGCTGACGGTGGTTATCGCAATTCG
ATCCAGGTGCGTCCGTCGCTGTCGAACGATGAGCTGGTCACGACGCATGACCTGGTGACCGAACTCCGCGGCGTGATGAACTCGAGCGAAGTGACCAAGC
CCACGGGACGACGATCGTTCACGAAGCCGCCATCGCCACCGCCGCCTCCACCAGTCGTGAAGCCCCGTGCTGAGACCCGACGCCGTTACGACCCCTACGG
CTACGATGAGCAGCGCCATAGTTTGCCATCGTTCGGCTCCAGTAAGGAGCCCATGCCATCGCCGATCCCAATGCGAAAGAGCGGCCCGTCGCCTGTGGGC
TCTTCCAACAGTCTTGGCAATGAGAAGAGTCACAATGACGCCATGGACAACACCGCGTCATCATCGGCCTCAGTGCCGCATGTTCACAGTTTTACGTCAT
CCAACGGTGTCCTCGTGGGGAGCAACGTCGTGAATGCAGACACGAGCCTTGAATCAGCACGGTATCAGCATCTTATGGGTTCTGGACAACTCGGTGACGG
CGAGGACGACGATGAAGACTCGTCCGAGGAAAACGACGACGATACGGACGACGACAACTTTGTGATGATGGGAACGTTGGAGCCACCAAAGTTGCGTCTG
CACAGCACCGAGTTTGGCGAACCGTTTTTCGCGAACCGCAACTTGGACTCCGAGTTGCGCGAAATGCGACGAGCGTCACCTGGTGAGAGACGTTACACAG
TGGGCGTGCGTGACGAGAGCGAGGATCTCAAGAAGCTCATGGAAGGACTGAGCCGTCCGCGTAGCAACTCAATGCCCTTTGGATCGAACCAACTTGGTGG
GACGCCGACTGCGGACGACGAGCTGCAACAACCGCAGTACGAAAAGCCCGCGTGGAGCGACAACATCCCGAACCGCGCACAGAGCGCGTACCACATCGAG
CAAACGCTGTGCGAAGTGCGCAGTTGTCTGTCGTCGTTCTTGGTCGAGTGTCCCTCGGGGTACGACCGCGAGCGCAAGCTGAGCTCGATCTTCAAAGTGC
TGCGCTCGCTGCACCGCGAGGGCGTGCGCTCCAAGTTCCGCACGTTGAATCACGACGACATCCGCTACACTAAAGTGCTTCGCGAGACGCCGAGCATCAT
TCGCCTGCTGAAGCTCGCGGGGTACGTGTCGCTGCCGCAGAAACTCACGATGCGCCGTGTGGACCAGGCGTACATTGGCATCATCCTGCGCGAGATCCAA
GCTGACTTGAAGCACTAA