Transcript Name :
Pytul_DAOMBR144PYU1_G000533
Orientation:
(-)
Number of Exons:
3
Description :
Similar to At4g26390: Probable pyruvate kinase%2C cytosolic isozyme (Arabidopsis thaliana)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-526
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K00873
K00873
K00873
K00873
K00873
K00873
K00873
Cluster Id
1873
Sequence
        1752 bases(100 bases per row)
ATGCTCCGTCGCCTCGCTCTCCGTTCGCTCCAGGCGCCTGCCGCCAAGGCCACGCGCTTCACGGCCACGCGCGCTTTCAGCCAGATCGAGGGCTACAAGA
ACCCTCGCAGTGACAAGTTCTCGATGACCAAGGTGCGTGTGTAGCGCATGTCTGCTTGCCTGGGGAGTGACACACACACATATATATACGTATACTGATT
GTGGCTCTCTTTGTGTAGATCGTCGGAACCATTGGCCCAGTGTCGGAAAGCGCCGAAATGACGCAACGCCTGACCGAAGAAGGCCTGCGCATCATGCGCA
TCAACTTTTCGCACGCCGAGTACGACGAAGCGCTCATGCGTACGTTCTCCATGCTCGCTCTTCATATGCATACTCCGTTCAGAAAAAGACTGACAGTAAT
ACGTATCCTATCTATGTGGCTCAGGCATCAACAACCTCCGTGGGTGCCGTGGTGTGCACTGGACGCCAGAACAGAACTTCAACCTCCGCGCCGTGCTCCT
GGACACCAAGGGCCCGGAAATCCGTACTGGCAAGATGAAGGACGGCAAGAAGATCCGCTTGGAGACCGGCAAGGAGATCACGCTGACCACCGACCCTGCC
TTTGAGAACATCGGCACGGCCGACAAGATCTACATCACGTACGAGAAGCTCGCGACGACCGTCAAGGTGGGCGACACCGTGCTCTTGTCAGACGGTCTCA
TCCACTTGACCGCCGTCAAAGTCGAAGGCAACGAGGTGCGCTGCGTGATCAACAACACCGAGGAGATCGGCAACCGCAAGGGCGTGAACCTCCCTGGCCT
CATCGTCGAGCTGCCAGCGCTGTCCGAAAAGGACAAAGCGGACTTGGACTTTGGCGTGAAGAACGACGTCGACTTCATCGCGGCGTCGTTCATCCGCAAG
GCGAGTGACGTGGAGCAGATCAAGGCCTTTGTGGCCAGCTGTGTCGAGAAGTACTGGCCAGCGGACTACATCGCGCCAAAGATCATCTCCAAGATCGAGA
ACCTGGAGGGCATCCAGAACTTTGACAGCATCCTCGAGGCCTCGGACGGCATCATGGTCGCGCGTGGTGACTTGGGTGTCGAAGTGCCACTGCAGAAGGT
GCTCACGTACCAGAAGCACATGGTGGAGAAGTGCAATGCCGTGGGTAAGCCCGTCATCGTCGCGACGCAGATGCTCGAGTCGATGCTCAACAACCCGCGC
CCAACGCGTGCCGAGGTCTCGGATGTCGGTAACGCCGTCCTGGACGGCGCCGACTGCGTCATGCTTAGTGGCGAAGTCGCACAGGGCAAGTACCCGATCG
AGTCCGTGCGCACGATGATGACCGTCGTGCGTGAGGCCGACGAGCTGCTCGCGAACGGCCACTTCGAGCTCGAGTTCGACCCGGCGACGTCGGACGTCGA
GTCGATCGCGAGCTCGGCCGTCAAGACGGCGCACGAGATGAACGCCAAGCTGCTCATCGTGCTCACGGACACGGGCTTCACGGCGCGCAAGGTCGCCAAG
TACAAGCCGACCGTGCCAGTCATGTGCTTCACCAACAACAAGAAGATCGGCCGTCAACTCCAAGTGCACCGTGGCCTGTACCCGATCGTGCCAGCGGCCC
ACGACCGCCGCCCAACGACCGCCGAGGCCATCCATGACGCCAAGAAGCTCGGCTGGCTCCAGCCGGGCGATCGCGTCGTCGTGCTCAGCGCCGACAACCT
CTCGGACGACCTCGGCAAACAGATCGTGCTGCGCGTGGCAAACGTGGCGTAA