Transcript Name :
Pytul_DAOMBR144PYU1_G000567
Orientation:
(+)
Number of Exons:
7
Description :
putative beta 1-3 glucan synthase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-286
400-419
494-513
1261-1313
1405-1469
1525-1535
1625-1667
1725-1730
1787-1797
1853-1935
310-376
443-473
537-1237
1337-1385
1493-1501
1559-1601
1691-1704
1750-1763
1821-1829
287-309
377-399
420-442
474-493
514-536
1238-1260
1314-1336
1386-1404
1470-1492
1502-1524
1536-1558
1602-1624
1668-1690
1705-1724
1731-1749
1764-1786
1798-1820
1830-1852
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
29
Sequence
        6736 bases(100 bases per row)
ATGGCGGCGGCGGGCAGCGACCGGCGGCGCGCAGGCTCCAACTACTTCCAGCTCGATGCCGACCGCAAGCGCAACAACTCGACGCGGTTCCAGAACGGCC
ACGATGCGCGCGAGACGTTCTCGACGCGGCTCTCGATGATGGACGTGATCCCGCAGCAGCAGCCGAACGCCAAGCTCGGCGGCGGGCTTCAGGGCGACTT
TGACGACGAAGTGTCGATCGACTATTGCTGCGAAGTGCTGTACAACAAGTTTGGGTTCCAGTCCGGATCGGTCGACAACCAGCGCGAGCACGTGCTGCTG
CTGCTCGCGAACGGCAAGGCGCGATCGAAACCGTCCGACCCGCCGGGACACCACATCGAGTCACTGTACAAAAAGCTGGCGGGCAACTACCTCGAGTGGG
TGCAGTTTATTGGCGTGAGCGCGGAATCGTACAAGGGACCGGTCCAGGGTAATCTGAAGAATGTGAAGCACATGGAGATTCTACTGTACTTGCTGATTTG
GGGTGAAGCAGGCAACCTGCGTCACATGCCAGAGTGCCTGTGCTACCTGTACCACCAAATGCTGATTATGCTGAACAAGGACCCACTCGGAGAAGACAAA
GTGAATGAAGGATGGTACCTTCGCCAAGTCGTGCGCCCTGTCTGGAAAGAAGCGAGCAACATGCAACGCAAGAACAGTCTCGGCAAGCATTTGGAGCACA
CCAAGGTGCGCAACTACGACGATATCAACGAGTACTTTTGGAAAAAGCACTGCTTGACCATCGACGTCACGAAAATCGGTGACGAGCTCACAGCAAACCA
CGGAAAGACGTACTACGAGCATCGAAGTATCTTCACGCTGGTGGTGAACTACTACCGCATTTTCCAGTTCAACATGATGTTCTTCATCATCCTAGTGGTG
CTCAGTTTTGCGTCCGCAATCTCTCCGAGCGGTGGTAAAATGTGGTTTGCCCAATTTGAGACTCTTGGAGAAGTTGTCGCCCCTTTCACCAAGCGAGATT
TGAAGTTGGCGTTGATCTCTTTGGTGTTCTCGCACTCGGCTATGGCAATGTTTAAATGCTTGCTTGAAGCAGCTCACGGCTGGCATCTGTTGATTGCTCG
TGAATCTTCTGCGTCCTCCTCGCGGTCGTTGACGTACGGTGGCGCGCTGACAGTCCGTTTAATCTGGAACGGTGCCTTTGCCGCCTTGTTCGGGTGGATG
ATCTACGAGCCGCTGAATACAGGTCAAGATACCGAACTTTTGGATAGTGCTCAGGTCGCGGCGGCAGCGTTTGCAACTCCTGGTGTGTGCGTGCTGTTCG
CTCAAGCGTTTGTACCTCACATCGTCACCAAGACATATGCGGCAAAGTTCATCCGCGAAGGCGAATCTTGCTACGTCGGACGAAACATGGCTCCACCTTT
CAGTTTCCAGGTCAAGTATATCACGTATTGGCTGATCTTGTGGTCACTAAAGGCATTCATCTCGTACTTCATTCTGGTTCGACCGTTGATGACGCCGTCG
TTGGCAATTTACACGATGAAGCTGACGTACAGCAGCAACGTGATTTCTTTCCACAACTTGGCGTACATCATGGCTTTGTGGATGCCGGTCATCTTCATCT
TCAACTACGACACCCAGATTTATTTCACGGTTTTCCAGGCGCTTCTTGGTTACTTCAAGGGTTTGCGGATGAAAACCGGAGAAATTCATGGTGTGAAGGA
GATTACCAAGGCATTTCGCGTGGCTCCGCGACTCTTTGACCAGAAAATCGTTACTTCACTTGCTCGTTCCAACGATGCTGCTGCCGACAATTCTGCGGCT
GCTTATCAGTCCCAAATGATGCTTCGCTTCGTGGTTGTCTGGAATGAGGTGGTGAATTCTTTCCGCGAGAGCGATTTGGTGGACGACAAGGAAGCAGCAA
TCTTGCAGTACGATATCCAGAGCTCCGGCGAAGTTTTCGAACCTGTGTTCTTGTCTGCTGGCAAATTGGCAGAGGCAATCGAATACACAGTGCGGTTGGC
AAAAGAAGGAAAAGGTGATTCGCAGTTGAAAGCCTACATGATGAAGAAAGATTGCTTGTCTGCTGTTCGGAGCTTCTTCACTGCTTGCATGTACGTGATG
GAGGCATTGCTCGGAAGTGACGACGCCGACGTTTTAGATGCTCTTCGTACGATTGAGGACGTTGCTGCTGGCGGCAACTTCATGAAGACCTTCGACTCGA
AGAGTTTGACTCAACTGCGCTCCGTCACGATGGAATTTCTGGAAGCCGTGATGGATCTCCCTGACCCTGACTCGCAATCGTCTCATTTGAGATCATCCCG
TGTCCACACTATGGGCGTTGTCCGCAACTTTGTCACGAAAATGGAGAACTTGCTGAACGCGATCCGAATTTTTGCGAATCGTCCCGAGCTCGCTGCTAAA
TTCGGGAACTCGAAGTTCTGCTCCAGTGCGAATGGGTACGTGTACGCTTCTCGCGGACTTGTGAACCTTTTCCACAACGACACAGCGATGGGCGCAGCTA
CTCGCGCCTACTTGTTGATGTCCCTGGAAAAGAGCGATGCGATGCCGCGAGTCCCTGAAGCACAGCGTCGTCTGGGTTTCTTTATGAAGTCTTTGGTCAT
GGAAATTCCGCAGCTGCAAGCGATCAAGGAGATGCGTTCTTTCTCTGTTATGACTCCGTTTTACAGTGAAAGTGTGCTGTACGCGCTGGATGAACTGAAC
AATCCGCTTGCCAATCACCCAATTTTCAAGAAGGTCGAGGAAGATGGCAAAAACATTACCATTTTGAAGTATCTTATCACCATCCATCCAGAAGAGTGGG
AGAATTTCCTGGAACGAGTGGACGTGAACTCAGCTGAAGAAGCCCAAACGAATTACCCGATGGAGATTCGTTTGTGGGCATCGTATCGAGGTCAGACACT
TGCTCGTACTGTTCAAGGTATGATGCTTTATGAAGACGCTATTAAAATTCTGCACTGGTTGGAAATTGGGTCGAGTCCTGGAAAGACCGCAGAGCAAAAG
CAAGCACAGCTGGAAGATATGGTGCGTCTGAAGTTTTCGTACATTTGCGCTTGTCAAGTGTATGGTAAGCACAGAGCGGAAGGCAAAGTGCAAGCTGACG
ATATCGATTACCTTCTCAAGACGTACCCGAATCTGCGAGTAGCGTATGTCGATACCGTTAGTGTCGAGGGTGGCAGCAAGCGATTTGACTCTGTGCTGAT
CAAGAGTGAGAACAACGAAATTGCGGAAGTGTATCGGTACGAATTACCAGGTGATCCTATCCTTGGTGAAGGCAAGCCAGAGAATCAGAACAATGCGCTT
CCGTTCAGTCGCGGCGAGTTCCTCAAGACCATCGATATGAACCAGGAGCACTACTTTGAAGAGTGTCTTAAGATGCCTCACTTCCTTCGTACGGCTGATC
TGCACCCATCGAAGAAACCGGTGTCGATTATCGGTATGCGTGAGCACATTTTTACCGGTAATGCTTCATCCCTTTCCAAATTCAAGTCGTGGCAAGAGCT
TGTTTTCGTGACCTTGTCGCAGCGTGTGCTCGCCGACCCCCTCTACGTTCGTATGCACTACGGTCACCCCGATGTTTTCGACAAGGTGATTGCTTTGTGC
CGTGGTGGTGTCTCGAAAGCAAGTAAGAGTATCAACTTGTCTGAAGATGTGTTTGCTGGTTTCAACGCGACCCTGCGTGGTGGTATTGTTACGCACGTGG
AATTTATGCAGTGCGGTAAGGGTCGTGATGTGGCTCTTTCCCAGATCTCGACGTTTGAAGGCAAATTGGCAAATGGTGCGGGTGAAACGTCTCTTGCGCG
TGAAGCTCATCGTATGGGCCAGTTTTTGGACTTCTTCCGCCTCAACTCGATGTACTACTCCCACACTGGTTTTTACTTCGCAACGTGGATGACCATTGTC
ACGGCCTTTGTGTACATGTACTGCAAAGTGTACATGGCTCTCTCGGGGGTCCAATCGGATATCATCTTCAAGATGAACTCGACGGATCTTATCAAGAACA
ATGTTGCCAATGGATTCGACGACCGAGTACTCACCGATCTGAAGGCTGTGGTGAACACTCAGTTTTACATCCAAGCCGGTACTTTCCTCATGCTTCCGTT
GATGTGCGTCTACTTCGGCGAAGGTGGTTTCATTAGAGGTATGGAACGATTCATCACGATGATTATCACTCTCGGCCCAGCATTCTTCGTCTTCCAGGTC
GGTACTACGATGCACTACTTCGACAACAACGTTCTGCACGGAGGTGCCAAGTATCAAGCGACTGGTCGTGGTTTCAAGATCACACGAGAAACGTTGGTGC
TGCTGTACAAATCCTACTCAGCTACGCATTACCGAAAGGCATTTGAATTGGTGGGCCTGTGCCTCGTGTATTTGATTTTCGGCAATTTCTTCATCGGTCA
GACCGATGCGCCAATTGGAGACGATATGTTTGCCTTCGAATTTCGCAAAACTGCTCAAGGCTACGGCGTGCAGACTTTCTCGATTTGGTTCATCTGTATT
CTGTGGATCGTTGGGCCATTCTTGTTCAATACCGATGGTTTGGATTGGGAGAAAACAAAAGTCGATATCAAAGCGTGGGCGACCTGGATGTTTGCTGATG
CAGACTACAAAGACGACGACCCGGTGAACAAAGGCGGATGGATTTCCTGGTGGAAAGGAGACCTTCAAGAATACCACAACTCCAACATGATTTCGCGTGT
TACGGTGCTGCTTCGTGAGAGTCGTCATTTTATTCTCATGTTCTACGTCTCGACGATGAAGACAGCTGATGTGAAGTACGTTGCCTTCACTTTTGGTGCA
GCAGTGGCAACCGTTGTACTGTTGGGATTCGTTCACGGGATTGGTTTGGGTATGAGATCGGTTCGCCCTATAATCCGTGCTGCGCTCTACTTGATCATTT
TGCTCGCTGTTATCGTGGCGTACTTCTTGGTGATGTGGATCGTCTTCGACAAGGACTTCAAGTACTCGATGTCTCTTTTCTTCGGATACTTCGCGGGACT
GTACGGTATCAATGAAGTGATGCGAATGTGGAGTTTTGCCAACTCGTCGATCGCGAACATCGTTGTCTTCCAGCAGCTGGCGTTCTTGTTCGACTTTATG
TTCTGCACGGCGATGATCATTCCCTTGTTCGTCATGTCAGGCATTCCGTTCCTGAACATTATTCAAACTCGTATGATGTACAACGAAGGTTTTTCGAAGG
TCATGTCAGCGTCGTCCCAGTATGCGTTCTCCTTGGCCACGTTTATGGGTCTCCTGGGTGGTGCCGGCTGTGGCTGGCTGTTTACTTTGCTGTCCACACT
TGAGCAATCTGCTAGTTTCTCGAGTTACGTGTCGTCCTACGAAGGAATCCTGACCGGCGATTATGGCAAAGTGACGTACATTGTCTACGGTGCATGCACG
CTTGGAGTGATCATGTCGGGCTGTTTGACCTACTTCATCGGGCGCCGCTTGGCGATCGTCACGGGTGGTCTTTTCAGTACCCTTGGTATGGTAGCTGTCT
GCGCAGATGATGACCTCCGTAAAACGCTGCTGCTGCCCGGTATTGGTCTCCTCGGTTGCTCGATTGGTATTCTCCTGCCTTCGCTTGCCATCTACATCTT
CGAAATCGCGACCAAGGATATGCGGGGTAAATCGGTCCTCATGCTTGGTACAGGTTTTGTGCTCGGTAGCTTGCTGAACCTGAGACACGCAACAGGGGAT
AGGCAAGGCACACAGGGGATAGGTTTGGTGCTTCCATAATGATCGCCATCATCACTCTGCTGTGAACATCCTCCCTGAAAGTCCGTTCTGGATCTTGGAG
CGAAAGGGCTGGGAGGCATGCGAAGCGTGCTTGGTGATTTTGCGTCGCAAGCCTGACGTTTCTGAGGAGTTGAAGAGCATTCGGGAAGAAGAAACCGGCG
ATGACCAGGGTGGAGGCAATGCATTCAAGTTTATGATTGGCGTGTTCCTGATGCTGGTGTCGTCGCTGTCTACGTGCTTCTTGAACTCCTTCGTGATCTC
CGAGGTGACGTCGTCCAACATCTTGAAAGACGAAACGCACATGTTTGTGAACTCGGTGGCATTGCAGCTGACTGGTTCCTTCTTGTCGTTCTTCTTCATC
GACAAGCTGGACCACAAGTCGGTGCTATTTGGCACGCTGATTCCAGTAGCTCTTTGCGCTGGCGTCTTGGGCTTCAACGAGAGCTCTGGCTTTTTGAACG
ACCTGAGCAACGCTGGCTTGTACTACAGTATGATTGTCATGCTGATGTACTTCTTCTTGGGGCTCGGTACGACCGCTGCACTTTGGACGGCGTGCATTGG
CATGTTTAACACCCGTGGCCGTGCTTCGTCAACGACGTTCCTCTTTGCGCTCTTCTTCATTGCACCGCTGGGGTACGTGTTCATGCACGCAGACGAATCA
CTATCCAAGAACGAGTACTTGTACTTGTACGCCTTGGCTGGCTTCTGTCTGGTTACGATGGTTCTTCTAGTCGGCGCTGGCACGAAGAAGAATGGTGTGA
TCTGTACGAAGCGTGAAGCCGAAGTGGATCGCGAAAAGGCCCAGCGCGCTCGTGCCGAGAGTCGCGGTCTGCGCACCCCTGGCAGCGCCCGCAACCGCAA
CCTCAGTCGCGCGCGCGCCAAGTCCAGTGCTGCCGGCGGCAACAACAATGGCAGCAGCCGTGGCAACAATTACCAAATGTTCGAGTCTCCTGCAGGTGGC
GCGCCCATGCCGATGAACAACATGAACCACGCTTAG