Transcript Name :
Pytul_DAOMBR144PYU1_G000576
Orientation:
(+)
Number of Exons:
1
Description :
Protein of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-62
118-128
212-229
287-310
371-376
432-489
550-565
86-94
152-188
250-263
334-347
400-408
508-526
63-85
95-117
129-151
189-211
230-249
264-286
311-333
348-370
377-399
409-431
490-507
527-549
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
4
Sequence
        1698 bases(100 bases per row)
ATGAACCGCGTGGCCAACGATAAGGTCGAGATCGCCCAGCGCGTGTCGTACATCAGCAATGTGTCGAACGCCAAGGACGCCGAGGACGGCTACGAAGGCG
CCAAGACCCCAGACGTCCTGGAAGCACAGGGCGGTGCGCTCCGCTCCGGCGGCGCTCCGAACCTCTTCAGCAAGGATCACATTGGCCTCATCATGCAGTA
CGCTGCCGTCGGTGTGGTCTACGGCTCGCTGCCAGCGACGATCTACCCGTTCTTGCAGTCGTACCTGAACGCGAGCGGCACGCAGGTCGTGACGGCGAGC
ACGCTCGTGGTGCTGCCGTGGTCGTTCAAGATCTTCTACGGCATTGTCTCGGACTGCTTCCCGATCTATGGCTTCCGCCGTCGACCGTACATGCTCCTCG
GCTGGGGCATCTGCTTCGTGATGCTCATCGTCATGGCTGCGACGCCCGTGGGCGACCCGTACTTCTTGAACCCCGACGACGCCGACGTTGATCCCGAGAA
ATACGATCAGCACCCAGGCATCGAGGACCGCTTGAACAAGAGCGCGCCGGGCAAGGCCGGCAAATACGTGCTGCTGATGATGTTTGCCGCGTTCGGATAC
CTCATGTCGGACGTGACTGCCGACGCCATGGTCGTCGAGCTCGCGCAGCGTGAGCCGCTCGCTGTGCGTGGTACGACGCAGTCGACGATCTACGCCACGC
GCACGCTCTTTGTTGCAATCAGCACGATCCTCACCGGCTTTGCGTTCAACGGCAAGGAGTACGGTGGCAGTTTCGACTTTTCGCTGAGCTTCCCGACGCT
CATGCTGATCCTCGCGATCTGCTTGGTGCCGGTGCTGCCGGTCACGTGGTTCTACATCGCGGAGGAGAAGCGCGAGCGCGTCGTGTTCACCGAGTACATG
TCAGACCTCTGGAAGCTCATTCAGACCCGCGCGGTGTACCAGATCATCTTCTACAACTTTTTCAGCGGCATCTTTGCCAATTTTTCGTACACGGCGGCGT
CGCCTGTGCAGCGGTACATGGTCCACGTCGAGCCGATCAACTCGACGATCAGTGATGTCATCGGGAACCTCGTGTTCTTGGCCGGTATCGCGGTCACGGG
CAAGTGGGGGCTCCACTGGAACTGGCGCTGGATCATCGTGGTCACGGGCGTACTCGTGATCGCCCTGGATGCCATCGTGGCGTTCATCACGATCTGGGAC
GTGTTCCGCAGCCAGTGGTTCTGGCTCGGCGTGCCGATCGCGGTCAACGTGCCGTCAGGCATCAGCTTCATCGTGTCCACGTACGTGATCGTGGAGCTCG
CGACCGACGGCAATGAAGGCGCAGTCTACGGTCTGCTCACGACGGTGACCAACCTGTCGCAGCCGTTCTCGGCCACGCTGACCAAGATCATCGACCAGAA
GTGGAACATGACGAACGAGCGCATCCAGCATGACGATCACTCGATTCGCATGGACATCACCGAGTCGATCATCCTCATGTACGCCATGTCGGTCGTGTCG
TGGTTCTTCCTTGTGATGCTGCCCAAGCAGAAGGCCGAGACGCAGGAGCTCGTGCGCACGGGTGGCTCGAGCAAGTTGCTCGGTATGCTCACGATCTTTT
ACGTGTTCTTTGCGTTCGTCTGGTCCGTCATGACCAACTTGATGGGCATCTTCGACAGCACGGCGTGCTTGGTCATCGCCGGTGGCGACGGGTGCTAG