Transcript Name :
Pytul_DAOMBR144PYU1_G000568
Orientation:
(-)
Number of Exons:
2
Description :
Similar to Cdan1: Codanin-1 (Mus musculus)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1194
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3706 bases(100 bases per row)
ATGGTGACGCCAATGAAGAATACGGCCAAGCCGCCTCCGACGCCGCTATGTGTCAAGCAGAAACGTCCTCGACGTCAACCGCTGCTCCCAAACAACACTG
AAAGCAGCCCTGCGCCACTGCAAGAGTCTTCTCCACATTCGCAACTCCAAGATGAGAAGAAATGCGCCGATAATTTCCAGATTAACGCTCAAGCAGCGAA
ACTCTATGGCTTCCTTATCCGCAAGCGATTCGTGGGGAGTACGTACACAGAGCTGCAGTTGCTGATCAGCCTGCTGTTTCGCTCAGATTGTACCGGCAGC
AGTTCCAGCGGCGAGTCATCGCCCGAGAGCGTGTCCACTTGCGGGTTCACGAACGAGTTTTGCTGGCGCAGTCACTGTCTAAGCTTTGCCGCACTGGTAT
TTAATGGCATCGAGACAACGTTAACAAGCCTCGGTGCTGACTTGCTCCGGTTGCTTATGCGCAGCTTGGCGGACGCCGACATCTGCGCAGAAATGCTGGC
GCGGCTGCAGCAATTTGCGCAGCGACGTGAAGAGCTCCGCGTCGAAGAAAGTGCGCGGATTGGGTGCAAACTTCCCATTGAAACCAAAGGTAAGGCATGT
GCAACGCGCCTCATTTTTTCGAGTGGCAACTCTGTGTTTATAGTACTGACGCTTCTATTGTGTGGTTTTGTATGTGATTGTGCGGTGCAACTGCCGGATG
TAATCTGCAGCCAGTGCCGTGCGGGATTTTGCATTGCCCTTCTGCGAGGAGATCGACTCGCGACTGCACTACCGGTCCCCGACCGAGTCTGTCATGTACT
CGAATCGCGAAAAAATCCGCGATGGGTTTCTCAATCTGCTGCGCCAGTTCCAGAAGCAGCAGCACAGTCTCGTCGGCATTGAAAATGCCAGTGTTGCGGC
AGCGGCGATTGACAATGCGAGGAAGCTGTTTGGAGAAGTCGCCCCGGAGAACCGGTGGTGGTTCGCAAAGTTCTTTGTCATGGAGCTTCTCCAGGTGGGT
TCCAACCCGTTCGGCGAGAGTGACAAAGATTTGGTTCTCAAGATCATGGAGGACAAACTTGTCGTGAAGAATCCAGATCGTCTGCGGAAGCTGCATCGGC
GATTTACGAGTCAAAAGCAATCCAACAAGGCACCCACGAGCTCAAATGGAAACCAAGGACCATCAGGCTCCAGCACGGCGAGTAACCATTTTGGATCGGC
CGCACCAAGCAAGCCCAATGGCGGCAATACTACCAGCTCGTGGAAAGCGGATCGTCCTGAGTCACGAAGTACTGGGGGTCCTGCAGCCGGGACAGCAACG
AATGGAGGGAACACTGCAATCACGACCACGTTTGAGAACACACGACAGCATTTCGCCGAGAACCAGCAGTTCTTTTTCCACTTTCTGCACAGCTGCGACA
GCTACGAGTTCTCCCAACTGGTCAAGTACCAACTGGAGTTCCAGTTCCAGTCGATCTGGAAGGAAACCATCAATGCGGATCCACGAAAAAATTTCACGGA
GACGGTGCTGAAGCTCAAAGTGGTGGCGAAGTTTCTCGGCTACCTCCGTTTTTCGCCGCAGTGGCACAATTCATCGTCGCTTGTGCAGCTCTCGAAGCAG
AACCCAGCTTTCAAAGCCGCCGAGAAGGAAGCGGTGGGGACCCTCGAGAATACGAACGACACGTTGGGTCTCGACGTGAAATTGCTCCTGGAGCAAAGCA
TCGTCGAGTCGACGATATCCAAGTGCGTACCGTGGCTATGCGATTATCTAACAATGTTGTCCTTAGACAAGCTCTCCACTGCGACGACCTACTTTAAGCA
GCTGCTCGTCCTCTTGGAACGCATCTACCATTCCTCGCGATTAGATGGTCTCGGGGAAACTGGATTATACATTGGTATGCAGATTGAGCGCGTGTTCCAT
GTGCTGGAGCTCGACATTGCTGGCTTCATGGACGCGGAATTCCGGTCGCCGTCACTCCTGCCGTCAAGTAAACTCTTGCTGATTCTCGAGGAAGTCGAAT
CAAGCGCCCAGAGTGGGGAAGACAATCTGCCGTTCCTATACAGCCAAGTGTTTGTGCAAAGCTGCGTGAATGAGCTGGAAGACCTCCGCGGGTTCATTCA
GACGCGCGCAAAGCCATCACACCGTGTGACGAAGCGCGCTGCAGCAGGTGGCGCTCCACTGTCTGGCGCTAGCCAGCTCACTGCGATCCGTAAACTTCGA
CCGCTTCAGGTGATCACGGAAGACGAACACAACGACACGACAGCGGACGCTACGATGTCGAGCACCGCGACGAGTCTCACGGACGATGACAGACTCTCCG
AATCCATTTTCAAGATCCACCCGAACTTGAAAAAAGTGGTCGAATTCGTCGTCGAAGTTGTCGCGACAAATATTTGCGAGCACGTTGTCCAGCAAGTCGC
GATCCCGAGCGCCGACGCGTTCGTGAATTCCTGTGTCAAGGACAGTGGGCTCGCTTCGCCGCAAGGATCTTCACTATCATCCTCTTCGTCCTCGGCCACC
TCGACGGAGCTCGAGGCCACTACAATCGTATTCCTTCAACTGCTTGAAAGCCGCGTGTTTCGCACCATTCAGGAGACGGTCGTTCGCTCGCTCCAGGAAA
CAACGCGGTTGTGCAACGACCACGTGCGTGCATCGATCCCACCATTGCTGCCTCCGTCTTGCCACCCGACGCTCGCGCAGTCGGTGCTACTGGTCGCACT
GAATCGTACCCGCGGCGTGACCAACAACCTGATTTCAAAGAGCTGTCGCTCTGAGTTCACGAAGCGACTCGCGCTCCGCAAGAAAGCGATTTTGAAGGAA
ACGGCGTTCAAGTCGGCGGCAGCAGCAGCAAACGCGCCCGCGCGCGACCAGGAACCCACGAGTAGTGGGGACGAAGACGACGGGAATGTTGTGCGTACGC
TCTCGAGTATGTTTGACGAGCACGCCGGCGTCGAAGACTCCCGCGAAGAGGAGATATTTGCATTGAAGCACGTGAGTGCGCAGATCTTCAAACTGAGTCG
AAGTCGAGGTGGAGGTGGGGAAAAGGCGCCACTTGCGATGGAAGACTGGACCAAGGTGCACGTGTCCGTGGCACGCCACCTGAAGACCTTTGCATCCCGT
TTGTACGCGCTGCAGCGTGCAGACGAGCGTCTGGAACAAGACAGTGGTGGCAGTAACCACGACTTGCCGGTTTGGGATGCGACGTGGCGTGTGACCACGT
CGTGTCTCCGTGTGCTCACGCGGTTCGGCGATGAAGTCGTCGTAGCCGAGTGGATGGACAATGAAAGAACCCAAGCTCCGAAGACCCAGGCGCTCGAGGG
CAGCGTGGCTGGATTCATTGATGCGTTCATCGCATTGTTCAGTGTCGCGACGTGTTTGTCCTCTAAGGAGCGATCTGCGCACACCGAAACGCAGGAGGAC
GTTGCTGTTCGACGGATACAGGCGCTAGTTGAAGTCGTTGTCGAGTCCCTCGTAGCGAAACCATCACAGCTGAATCTCGGAGCTCGCGCCTGCGACTCCG
CTGTTCTCGAGCGGCTCGTCTTGAATCCACGAGCCAGGATTCTCGCAGCGTTAATGACCGCAAACGATGCCGAGCCTGCGTTCCTGACGGCCCAGCGCTC
GTTCACGCAGCACGAGCCCCACGATAGCAACGCGACCAAGTCACTGAGTGGTGCCCAGCAGTTCCGCTCCGAGGTCTGGAAACGCACGACCGCGCGCCAC
AGCTAA