Transcript Name :
Pytul_DAOMBR144PYU1_G000547
Orientation:
(+)
Number of Exons:
2
Description :
Similar to rpsP: 30S ribosomal protein S16 (Acidiphilium cryptum (strain JF-5))
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-106
NN-scoreoddsWeighted Score
0.7363.5890.007
*** None ***
TypeScore
mitochondrial478
GO
*** None ***
KO ID
K02959
Cluster Id
1869
Sequence
        434 bases(100 bases per row)
GGAAAAGACGAGATGGTGGTGAGACTGCGACTCGCGCGCTGGGGCCGCAAGGACCTCCCGTTCTACCGCATCGTGGCTGCCGATGCGCGCGCGCCACGTG
ACGGCAAGCACCTCGAAATCGTACGTCCAGCTTGTCCTTCTCTGTGTCGAATTGGTGCTTAAAGTCGTGGAACGAACGCATGACTCATCTTGTTCTCTCT
CTGTTGGCGGTGATATAATAGTTGGGCACGTTCAACCCGATCGCCGCGGCCGATGGCGTGAAGGAGCTGCGCGTGAACAACGAGCGCGTGCGATATTGGA
TTTCAGTCGGCGCGCAGCCGTCGGACCGCGTGAGCCACCTGCTGGGCATTGCCAACATCCTGCCGATGCCGCCCACGCGCCAGTACGGCATCAAGAGCAT
CCCAAAGAAGGACCGCGCGCCTGCCAAGAAGTAA