Transcript Name :
Pytul_DAOMBR144PYU1_G000565
Orientation:
(+)
Number of Exons:
1
Description :
Similar to mcd4: GPI ethanolamine phosphate transferase 1 (Aspergillus oryzae)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-6
515-533
613-616
674-679
730-741
832-855
911-929
987-1009
30-491
557-589
640-653
703-711
765-808
879-887
950-963
7-29
492-514
534-556
590-612
617-639
654-673
680-702
712-729
742-764
809-831
856-878
888-910
930-949
964-986
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K05285
*** None ***
Sequence
        3030 bases(100 bases per row)
ATGGCCCCGAGCAGCGGCCGCAACGCGCTGCTGGTGCTGGGCGTGGTCTTCCACGCGATCTACGTGCTCAGCATCTTCGACATCTACTTCAAGTCCCCCG
TGGTGGCGCACATCGAGAGCGTGCGCTATGCCGACCACACGCCGGCGTCGTCGTCACTGCTGCCGCCGCCGGCCAAGCGGCTCGTGGTGTTCGTCGCCGA
CGGCTGCCGCGCCGACAAGTTCTTCGAGGTGAACGCGACGCAGAACCCCAGCGTTCAGGGAAACGATGATGGCAACAAACAGGAGGGCCGTGTGGCATTC
CTGCGCCGCATGGTGGAGACGCAGGGCAGCTGGGGGGTCTCGCACACGCGCGTGCCGACGGAATCGCGGCCGGGCCACGTGGCGCTCTTCGCCGGCATGT
ACGAGGATGTGAGTGCCGTGACAAAAGGCTGGCAGGATAACCCCGTGGACTTTGACTCAATCTTCAATCAGAGCCGGCACTCGTGGCTCTTTGGAAGTCC
TGATATTGTGCCCATGTTTGCGCGCCACGTGCCGCACGCGACCGAGTGGCACTATTCGCACGAAGAGGAGGACTTTGCGGCCAAGGATGCGTCAGAGCTC
GATGTCTGGGTGTACAACCAATTTGCGACGCTCTTTGACCGCGCAGCGACCGATGACGCACTGGCCCAGAAGCTGCGGTCTCCGCAGTTGATTTTTTTCT
GCCACTTCCTCGGCATCGACACGAACGGCCACGCACATCGTCCGAACTCCAACGATTACTTAAACAACATTGCGCTCGTGGACGAGCTCGTAGAGAAAGT
CTACCGGCTCATGGAAGACTTTTATGACTACGACGGCAAGACCGCGTACGTGTTCACGGCGGACCACGGCATGAGCAACAAAGGCGCGCACGGCGACGGC
GATCCGTCGAACACGAGAACGCCGCTCGTCGCATGGGGCGCCGGTGTCGATGGACCCGTGAAGGCAACTTCTTCTCATGAGCGTGATCCTAAATTTCGTA
TTGACCTGCCGACGCAGTCGAGAGCGGACGTGATGGCGCAATTGGATGCGCAAAAGATCCAAGAAGATGCTGCGGCAAAGGAGTGGGGAAATCTCGTGCA
TCTTACGCGGAAGGACGCGATGCAAGCCGACGTCGCGCCGCTCATCAGTTCGTTGCTCGGAATTCCGTACCCACGCAACTCTGTCGGCGTGCTGCCCTTT
ACGTTCTTGGCCAAGGGCAAGTACCGCGCCAAGGCCGTCATGTCGAACGCGCAGCAACTCTACATGCACGCGTTGCGCAAGGAGCAGGAGAAAGAAGCGC
AGACGCTGCTGTTCTTTAAGCCGTTCCGTGCCTTTCGAGACAAGCTGCCGCGCGTCTCAAAGCAATTGAGCGCGTATTGGGATACGCAGGATTTTGACCG
AGTAGAGGCCTTGAGCCAGGAAATGATCGCGATCTGCCTCGAGACGCTCGAGTACTTTCAGCGGTACGATTGGTTCTTCTTGCTCAGCGTAATCGTGCTG
GGGTACAGCGGCTGGATCGCGGTGATTGCGATTGCGTTCTTGCACCCGGCGCAATTCCACGTGAATTCTCTCGTAAAAGCCAGCGACGTCAAGCTCTGGC
TGCTCGTATTCGGTGTCTTCACGTTCCTGACGCTCGAGAGCTCGCCGTTGACGTATTTCCTGTACATCTCGTTCCCTGTGGTGTTTTGGAACTTTGTGTG
GAACCACCGGCATTTGTTACGTGCGCCACCTTCTAAGAGTGGAACAGCGACGACAGAAGGAAGCAAGGCGTGGCGGATACGGGGATGGCTCGAAGGTGGC
TTCGTGTTGCTCTGCTTGGAGCTGGTTGTACTGGGCTACGAGCGGCGGTTCATCTTTGGCGTGATCTTCACGCTTTTGGGTCTTTGGCCATTGGTGGATG
GCTCGTTTGGTGCGAACAAAGATGATGCCGAGACCTCGACGTCTTCTTCGTCCACGAATAGCTTGACGTTTACGAGTTGGACGGCCAGTTGCCTCTTCAT
TTCGGTGTTTCCGTACCTGTCGACCGAATACGGCGAGCACACGCTTCTGGTCGTCGCTGGTGGCATCGTCCTGCTCGCGTTCGCGCTCGTTGTCGTATCT
CTCGTCACCCGTTCTGAAGGCAGCAGCAATATTTTTGCAAAGTGGGGCGTATCCTCCGCCGTCGTCCTTGGGTCGTTGATCCTGATGCAGCAGACGATGA
ACTACCTCGAGGACAAGCGCAAGCCACCGTTCGTGCTCACAGTCGCCAATTGGATCGTGTCCATTGCTCCAATTATCGTGCTCGTTGTGCGCCTTTCGTC
GAAGACGACGCAACTGTCGAGCAGTTCACAAAGCGTGGAGGCATGGGAACCGAGAGAAAACAACAAGGAACGCACCATGATACTGCGCTTGGTCGATGTC
TTGCTCGCGCTCAGCCCGTCATACATTTTGTTGAGTATCTCGTACGAAGTGTTTTTCTACGTCGCGCTCTGCTGCGTGCTCGTGAGTTGGATCTCTCTCG
AAGCGCACCTGAGTCGTAGCGCTACTATCGCTTCTTGTCAGCTCTGGCACGAAATCCGGCGCGCGTTTTTCTTTTTGCTGCTAATCAAGATCGCGTTCTT
CGGCACGGGCAACGTCGCGAGCATGAGCAGCTTCGAGATCTCGTCCACGTACCGATTCGTGACGGTGTTTGCGCCGTTCCTCATGGGCGCGCTGCTCGTG
ATCAAGATCCTGATCCCTTTCCTGCTCGTCGCGTGCGCGTTCCACATGGTGCTCGCGCTCGGCGGTGGCAGCCACCCGCCGTCGCGGTATTTCCTGCTCG
TCGTGGGAATGTCGGACATCCTGGCGCTGCATTTTCTGTTTCTGGTGAAAAACGAAGGAAGCTGGAAAGAAATCGGCAACTCAATCTCGATGTTCGGCAT
CGTGAACGCGCTCATCGTGTTCGTGCCGCTGCTGTTCCTCGCGGCCAAGGTGCTTGTGCGGGACCTCGTACTTTCTGCCGATGCTAAGGATGCCGCCACT
CGTCATGCAAATCTTCACAAGCAAGAGTAA