Transcript Name :
Pytul_DAOMBR144PYU1_G000542
Orientation:
(-)
Number of Exons:
6
Description :
Similar to PTDSS1: Phosphatidylserine synthase 1 (Cricetulus griseus)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
66-76
127-189
245-292
345-350
408-436
1-47
95-103
213-221
316-324
371-384
455-455
48-65
77-94
104-126
190-212
222-244
293-315
325-344
351-370
385-407
437-454
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
918
Sequence
        1857 bases(100 bases per row)
ATGGCGGGCGTGAGTCTCCATTGCCGCCGTTGCAGAAGCCCAAGTCGCCAGGCAACGGCGTGGGACTGAGCCCACGACTCGGCGAGGCATTCTCGTCGGA
CAACATGTTCCGCGCCGCGCGCGGCAGCGACATGGAGAACCTGCTGCTCTTCCGCGAGCAGCCGCGCCAGATCGCCGTGCTCGGGCTCGTCGTCGCCGCC
GTGTCCTACTTTTCGTTCACCCACGACTCGCAGGTGCGTCATATTTGCGTAGAGTAGCCAAAGGGGGGAGATGCTATACTGACGATTGTGATGTATGGGG
GCTATTGGATGCATTAGGATGTGACGGAGAACGTTCGCAATGGACTGTCGGCGGGCGTGCTGATCTTCCTCGTCTACTGCTTCCTGCAGACGCGCGATGG
GCTCATGGTACGTCGTTGTTTATAGTAATAAACACGAGTGGCGTCTAACCTGCATATTATGCTGTCTCCATATGAGTAGGTGCGGCCCCATCCTGGACTT
TGGCGTATCGTGCATGGCTGCTCCGTCGTGTACCTGCTTCTGCTCGCAGCCATGTCGGTGCAAAACCGCCAGGGCGCGATCCTGTCGATGCAGTTTCTCT
TTCCCGAGGTCGGGTCCATGAAGAAAGCGGTTCCAGGCGCGCCGCTGGAGTGCGACATCAACTCCAACACGATATACCGTGGCGTGTCGAGCATATGGTT
CCTTGCGCACGTGACCGGGTGGTGGGGCAAGATGTGCATGTTCCGCGACTGGCGCTTCTGCTGGGTGCTCAGCATCGCGTTCGAGATTTTGGAGCTCGCG
TTCCAGTTTGTGATCCCGGATTTCCAAGAGTGCTGGTGGGACTCGCTCTTCATGGACCTCCTTGGCGCCAACCTGCTGGGTATGTTCCTGGGACGCCTCA
CGCTCTGGTACTTTGAGACTAAGGAGTACGACTGGTCGGGTAAGAAGGAGAAGAAAATGGGCTACATGCTCCTGGTGCTCAGCCAGTTCACGCCGATCAG
CTGGTCGCAATACCACTGGGAGGTGTTCTCGAGCTTTAAGCGCTTTGCCCAGGTACGTTTCCAGGCTTGATGTCATTGAGCCTAAGTTTACTGGCGTTTG
ACACTTGTGTCTTTTTGTCTGATTGTAGATCATGTTTGCACTCTTCGTGTGTCTGCTCGTAGAGTTGAACGCGTTCTTCCTGCTGAACACGCTGAGCATC
CCGAAAGAGAGCAACTTCAACGCCTACCGCTTGTCGCTCGTGTTCCTCATCGGTATCCCAGGCGCAGCCGAGGTAAGCAAGCGGTTGTTTTGAATGTGCC
CTTTTGAAATGCGTCTGTGCTAACTAGAGTCTCTTTTTATGTGCTCGTATCTGCTCCTAGTACTACGAATTCCTGAGTAACCCGGAATGCCAGCGTCTAG
GCCAAAACGCGTGGATGATCCTCTCGATCGCGGTGTTTGAGGTGCTCGTGTGGGTGAAATTCTCGGCCAACGGCGTGCTCTTCAACGACGCGCCGCCGGC
GCTCGTGCTGTACCCGATTCTGGCGTTCGCGGCCATGTTCTCGATCTGGATGGTGTGCTTCTTTTCGTCTGCCAGCCAACGGCATGCGGCCCCAAAGCAT
GCATCGCCGCGCATCGCAAAGCTCTACCAGGTCACCACGTGGGGCAAACTCGACGTGCTCTTTTGGCTCTCATTCACGCCGCTGCTGCTTCTAACCACGC
AATGGGCTTACTAAGTGAAAGAAATGAGTGGTGGAGATTGCGAGTTGCACGTTTTGCATTTTTTATATCAGGGAATAGAATAGAGAGAGGAAGAACATGA
CATGCATGGTTTGCGGTGTGGATGACGAATAAGGGACACGAGAGAGAGAGAGAGTTG