Transcript Name :
Pytul_DAOMBR144PYU1_G000570
Orientation:
(+)
Number of Exons:
4
Description :
Similar to SFRS12: Splicing factor%2C arginine/serine-rich 12 (Homo sapiens)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-343
*** None ***
PositionContextScore
198SRSPTRR|SH0.564
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1343 bases(100 bases per row)
ATGGCGCGTGAGCGTACGTCGCGCTTCCTCTCGTTCTGTTTGCTCAGCATCTACAAGCGACGCCCTGCAGCCGGCCGCACCACCACGTCTCTGTGTATGT
GCTCACGCTTGTTTTTATTTTGCGTGTTCGTTTGCTGGTTGTTCTCTTACGGCAGGAGAGAGCAAGAAGGTGTCGCGCCATCATCACCATTCGTCGTCCA
AGAAGAGCAAGAAGAAGCACAGCAGCAGCAGCAGAGACAAGGACAAGGACAGAGACGAGCGGCATCAGCAACTGCCGAAAGGTGTCGCGCCGATCTCTGA
TGACGACTATTTCCTGCGCGCCACGGAGTTCCGCGTGTGGCTCGCCAAGACCAAGTACGTAGACATCTTGGTCTTGTTTTTGATGACATTTTGGACTCGC
TGGTAATGTGCGTATGTGTTTGCTGTATATGCAGAGACAAATATGTGGAAGACCTGTCGACGGCGGAAGCGATGGAGCTGTTCCAGGCGAAGTTCGTCAA
GAAATGGAACCGCGGCCGCCTCGCGAGCATGTACTACGAGGGCATCCCCGAGCACGTGCTCGAGCAGACCAGGCGCACCAAGCACAAGTGGGGCTTCACC
AAGACGCTGAGTGAGAAGGAGATGTTTGACCTCGCGACCGCCAAGGACTCGGTCGGCGTCGCCACGCGCAAAGAGGATTTGCTGCAGAGCACCAGGAGAC
ACGTTGGCACGTCCGATGGCGGCCATCGCTCCCACAAGCGCGCGGCCAACTCGGACGACGACGACCAGGACCGCCAAAGACATGGAGAACGGTGCTCGAG
AAGCCCCACGCGACGCAGTCATCGCGCGCACGAGGACTCCGAGGACGAGCGAGAGCGCCGCCACACCAGCAGCAGGTACGAACGCAAGAAGCACCGCAAG
CACCACGAAAGCGTGCTGGACGAGCTCGTGCCGAAAGAGACCGGGCGTGAAGCGATGCTCGAGAAGCGGCGCCAAGTTGCCTCCAAGATGCATGGAGCGG
CTCGAGACCGTGACGAGAATCGCGATGGACTCGACTTGAGCGACGACTTCCTCATGGGTGGAGGCGTAAGAGCCGAGACGGACCTGCAACGACGACTGAA
GCAGCGTGAAGCCGCGCGCGATCGCAAACAGCAGGAGCAGAATGAGAAGCGGGCTGAACTGGAGGTATGTTTGTCGAGGCATTGTGTGCGTATTGGCGCG
TCCATTGCTTTTACTGAGTGCTAAACCGAAGTTGTTTGCTTTCTCTACACTAGGCCAAGGAGTCGGCGCGCATGGACAAATTCTTGCACGACATGGGCAT
CTCGGCCAACTCCAAGCCGTTCACGATTGCACCGCGGCGGTAA