Transcript Name :
Pytul_DAOMBR144PYU1_G000550
Orientation:
(+)
Number of Exons:
4
Description :
Similar to Ppp1r8: Nuclear inhibitor of protein phosphatase 1 (Mus musculus)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-413
NN-scoreoddsWeighted Score
0.7342.6870.005
*** None ***
TypeScore
nuclear652
GO
*** None ***
*** None ***
*** None ***
Sequence
        1531 bases(100 bases per row)
ATGCCGCTGCGCGAACCCGCGCCGCCGCTCACGCTCTCGTTTGGCATGACGAATACGAACGAGACGATGACAGCAGCAGCACCGTCGGCCGAGGACGCCG
CGTCGAATGCGTCGACGATCCTCGACCAGTGTCTGCAACTCCCGAAGCTCAACCTCGGCAGCTGCAGCATGCGCAGCGGGACCGGCGTCAGCACCGCCGG
CGTGCGCCGCAAGTACCTCGAGCTCATCGAGCCGCTCAAGTACCCGTTCACCACGGGCGCACCCGCGTGGTGCGTCCAGGACTTCCCCGAGAAGAAGCCG
CGCGCCATCTCGCTGCTCGACGTCTACAAGAACCACGAATTCCTCACAACGGTATGTGCTTTTCTTTATATATAGGTGTCTTTCCTAGTGAATTATGAGG
AGCTCATTTTGTATTATGGCTTTTGTTTTGTTTTGTTTTGTTTTGTAGCACACGGTGTACCAGAAAGGCATGTATTTAATCGGCCGCAATGCCGCGATTT
GCGATATCGTATTGAGCCACTGCTCGATCTCCAGGTGCGATTTCTTTTTTTTCTTTCTATACGCCGACCACTTTGGATGACTACTTGCTGCTGTTATTGA
CGTATATGTATATTAACATATGTGCTCTCCATTTCCCAATAGACTGCACGCCGGCATTATGCATCACGAGGATGGCACGAGTGTGTACCTCGTGGACTTG
GGCTCGGCCCACGGCACGTTTCTCGACGGTGTGCGCTTAAAACCGTGCCAACCGACGCTCATGCTGCATGGCTCTCAGCTCAAGTACATATTTACTCCTC
TATCTTGTGTTTATCTGCTGCATGATCCGTTCTTAACAGCTGGTGTGTTTGCGAACTTCTTGTGCAGGTTTGGCGCGTCGTCTCGATCCTATACATACAA
ATCGTTTGACTCGCGCGAGCAGATCGCGGCGATCGTGAATGCGCAAATCGGCCTCAACGCCGACGAACTGGAGCTGAACCGCAACACGCTGCTGAACCGC
GCGGTGTCGTATCGTCTCGAGTTGTCACCGAGCATGCAGAATGGCGACGACGACCCGATGGCGTACCCGCAGCAGTACAACGGCGGGTTTGTGGCGTCGT
ACCCGGAAGATCCGCAGGGCCACCAGCGTCGCAGCAGCACGGACGACCTGACGCTCTCGCTCGCGGCGTTCCGTCACGACGAGCAACCCGCCCGAAAGCG
CTCGCGCGGCCAGTCGGGCACGTCGCAGGGCTCGTCAGACAACTCGATGGGCGGCGACGCGTCGCACTTCGCGCTCGACAACATCGACGTTCAAGATGTC
GAGGAGGAGGAGGAGGAGATGATGTTGGCACCCGCAGCAGTCCCCAAGCGCGTGCATTTCACGCCGCATCCGCCCACAGAGATCCCACCGATGACGTACG
CGTGGAGCATGGCCGCAGCCGACGCCGAGCGCGACGCATCCCCACAGCCTATCGACAGTGGCAGCGCCGTGGCGACGGTCGGAGGAGGCGCGTTCGGTCT
AGCCATCCAGATCACCTCGGACGCGCACTAA