Transcript Name :
Pytul_DAOMBR144PYU1_G000539
Orientation:
(+)
Number of Exons:
2
Description :
Similar to Glutamate synthase [NADH]%2C amyloplastic (Medicago sativa)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-546
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K00266
K00266
K00266
Cluster Id
4605
Sequence
        1864 bases(100 bases per row)
ATGCAGTCGACACTTCGTACAAACGTTTCCCGTCTTGCTCGCCGCCAATCCGCCGCGGGCGCATCGCGACGCTACGCGAGCGCCGTGAACACGAACGAGC
AAGAAGAGCTCTTTGAGAAACGCGATGGCTCGATCGGCAAGATCGTCAGTGAACGCGCGTTCATTGAGTTCAAGCGCCAGCCGGACCCGTACCGTCCAAC
GTCGGAGCGATTGCACGACTGGAATGAGATCAATACCGACACCCGCGAACCGGTAGAGCGCAAGATCCAAGCCGCGCGTTGCATGGACTGTGGCACGCCA
TTCTGCCAGACAAATACGGGCTGTCCTGTGAACAACTTGATCCCGGAATGGAACGAGTTGGTGTTTCGTGACGAATGGAAAGAAGCCATTGACCGATTGC
ACAAGACCAACAACTTTCCGGAATTCACAGGACGCGTGTGCCCTGCGCCGTGTGAAAGTGGCTGTGTTGCGGGCCTTGTCGATGATCCGATCACGATCAA
GAACAACGAGTACGCTATCGTTGACCGCGCGTTCGAAGAAGGCTGGATCGTGCCACGCATTCCTCGCCGCAATGGTCTTCGAGTCGCCATCGTTGGCTCT
GGTCCCGCTGGTCTTGCCGCTGCTGATCAATTGAACCAAAAAGGTTACCACGTGACTGTGTACGAGCGCGAAGACCGCATTGGTGGTCTGCTCATGTACG
GTATTCCAAACATGAAGTTGGAGAAGAAGACGGTGAACCGAAGAGTCGACTTGTTGCGTGAAGAAGGCATCGAGTTTGTGACAAATGCTGAAATTGGCAA
GACCATTCCAATGGAAGAACTGCAAAGTGAAAACGATGCGGTCGTACTGTGTCTCGGCTCGACGGTTCCTCGTGACGTGGACATTCCAGGGCGTGATCTG
AAAGGTATCCACTTCGCGATGGAGTTTTTGACAAAGAATCAGAAGCGATTGATGCTGACTGTCGACGGCAAGCTGCAAAGTGGCTGGGATCGCAACTTCA
TTACTGCTGAAGGCAAGGATGTTGTCGTCATCGGTGGTGGTGATACCGGCACGGATTGCAGTAAGTACCGCTTGATTTGTGTTATTTATTATTAATGGCT
AGTTGTACTAACTTTCGTTTGTGCTTTGTAGTTGCCACGTCCATGCGTCATCGCTGCAAGTCTGTGACGAACCTTGAATTGAACCCTCAGCCTCCAGCGT
CGCGTTCAGCAGCGAACCCATGGCCAGAGTACCCTCGTATCTATGGTGTCGATTATGGCCACGCGGAAGTGCGTGCCGTGTTCGGCCACGATCCTCGAAA
GTACAGCAAGTTCACGAAGGAATTCAAGGGTAACGACAAGGGCGAAATCACGCATGTGGTGACGCAGATGTCTCAACGCGACCCAAAGACCGGTATGTTT
TACCCTGTGGAAGGCACCGAAGAGAAGCTGCCGTGCGACCTGGTCTTGCTTTCTATGGGTTTTTTGAACCCAGAACAGACACTCGCCAACCAGTTGGGCT
TGGAGGTTGACCAGCGCAAAAACATTCGTGCTACGTACGGTAACTACCAGACTTCTCAGGAGGGTGTTTTTGCTGCGGGCGATTGCAGACGCGGCCAATC
TCTCGTCGTGTGGGCAATCAACGAAGGCCGAGGCGTTGCCGATGCCGTTGAGAAATACTTTTTGACCGAAGGTTTTCAGCCAGAAGTGTCTCAAAACCAG
CGCTATGGTTAGGCGGATAGTGATCGTAGCAAGTTCGACAAGAGAATGGTGTGTGTAGTGCTAGAACAGCCAAGGAGCGGCCTTGAAAAGGTGATATTTC
ATAAATGTTTTATTGGGGGAAATGTGAATGCATTAATTGAGAAACATGGCAAACTGAAGAATAC