Transcript Name :
Pytul_DAOMBR144PYU1_G000535
Orientation:
(+)
Number of Exons:
1
Description :
Similar to yqjV: Uncharacterized MFS-type transporter yqjV (Bacillus subtilis)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
43-78
125-144
197-284
340-358
433-438
1-19
99-101
168-176
308-316
382-409
462-468
20-42
79-98
102-124
145-167
177-196
285-307
317-339
359-381
410-432
439-461
*** None ***
PositionContextScore
247DDDRKKR|KN0.513
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1407 bases(100 bases per row)
ATGCTGATGCGGTGGTGGAGCCGCATCGCGCACAATGTGCAGACGGCGTACGTGTTCACGCTCTTCTACTGGGCCGCGCGCAGCATCCTGTTCCAGCAGG
TGATCTCGGGCTACGTGTTCGTGCTCACGAACTCGAACAAGCCCGTGGGCATGGTCAAGGGCATCCAGGGCATCTCGCAGCTCGTGTTCTCGTTCCCCGC
AGGCTACTTTGCCGACCGCACCCGCCGCGACACGATCCTCAAGCTCTCGTGCGCGATCGGGATCGTGGCATCCGTGCTCACGTTCTATGCCGTCGAGGCG
AGCATCATGAACCTGCTCTACGTCACGTTTGCGCTCTGGGGCCTCTTTGCGGCTCTGCAGAGCCCCGCCATGGAGGCGCTCTTCGCCGACTCGATCCCGC
ACGGCGAGCGCTCGTTCCCGTTTATGATCAAGTACAACGTGAGCAACCTCGCGATGATCCTCGGCCCGGCGATCAGCATCTTGCTGTTCCTGTACTACGG
CGACTCGTGGCACCTTGAGCAGCTCAAGCCCGTGCTCGAGTTCGGCACGGTGCTGGCGGTGATCGCGTCGCTGCTGCTGCTGCGCTTCGACGACGACCTC
GCGTACGAGAACATCCGCGCCAAGGAGCAGCACACGGAGAAGGAGGTCGAGCAACCGCTGCTCACGCCGTCTGTCGTGCGCAACGAGCTTGAGATCGACT
ACGAGTACTCGGACGACGAGGATGACGACCGCAAGAAGAGGAAGAACGCCACGGAACGCTCGTCGTTGCTTACGACACAAGAAAATGGCGACATGGAAGA
AGGCTACCTTGCGCGCCAGGACGTGCGCTTTCTGTGCTTCCGCACGCGCCACGTGCCGTGGCTGCTCTTCTTCTCGGACTTTATCATCAGCAACGGCGCC
GGCATGACGATCAACTTTTTCCCGCTCTTCTTCATGCAGGAATACGGGCTCACGCCGATCCACATCAGTGTGCTGTTCATCAGCCAGCCGCTGCTAGTTA
TGACGCTCTCGTTCTTGACGCAGCGCATGTCCAAGAGCTTCGGCCGCATGCCGATCATCGTTTTCACGCGCTGCTTCTCGGTGCTCTGTCTGTTCTGCAT
GGCGTACGCGCAGCCGCTGGCGCTGCAGGTCGTGCTGTTTCTCATGCGCGGCGGCATGATGCGCTGCTCGCAGCCGCTGCGACGCTCGATCCTTATGGAC
TACGTGCCCAAGGACATCCGCGCGCGCTGGAACGCCATGGAGGGGCTCTCGGTATTCTCGTGGTCCGGCAGCGCCGTCGTCGGCGGCTACATCATCGACG
CGTACGGCTACCGCACGTGCTTCCTCATCACGTCGCTCGTGTACGTCTGTGGCCTCGGCCTTGAGACGTTCCTGCTCCCGTTGACCAAGCATGCCGTCGA
GAAGTAA