Transcript Name :
Pytul_DAOMBR144PYU1_G000559
Orientation:
(+)
Number of Exons:
5
Description :
Similar to DDB_G0277313: Protein TAPT1 homolog (Dictyostelium discoideum)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
306-324
420-542
598-629
1-282
343-396
561-574
283-305
325-342
397-419
543-560
575-597
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
4557
Sequence
        2286 bases(100 bases per row)
ATGGGGCGCACTGCGGGCGAAGACGAGAGCTTCGCGGGTGGCAGCACTGTCTCCACCGCCATCGATGGCTCGGACGCCGGGAACTTCCGCGTGCTGCAGC
GCCATAGCAGCTCCGAATCCATCTTGCGGCGCCGCAGCAAGAGCAACCCCACGACGTCCACGTCTCCGAGACCGACGCCCGCGACGCCGACACCCATGAC
GCCGACCAAGCGCGCGATGCTGACGAACCGGTTCCTCTCAGGCGACACAGGGGATAACGACGTGAAGAACGGCATCACGCATTCACTGTCGCTCCCTGTA
GCAGCTGTGGATGCGATGGGTAGCACGAATGGGAATGCGCAGCCAGTGGCTCGCGTGGCATTCCTCACTGCACCCCCATCTCCGAACGACGCTCATGTGT
TGAAGTCGCGCTCCATGGGTCACAGCAGCAGCACGAACGCGAGCCCCAAGGTGGGTTCTAACAGCAATAGCAGCAGCAGCATGACGGCGCAGTCGCCGCT
CGCGATGCAACGCATGCAGCGACTGCACAACCTGCAGGTGCAGACCGATTTCTCGCTTCCAGCATCGACTGTGATCCACCAGAGTCCGCGCATGGCCGCC
AGCGTGAAGAGCGATGACAAGGCAGTGACACCGACGCTGGCTCAGGAATCACACGCCAAAGCAATTGTACCGGGCACTGCGACTGCGCCGTCGCAGCCGC
AGCCGCCACCGCATGCGTTCCGACTGTCGGACTTTTTTTACAAGGAGATCTTTGGCGTGCACGACATCAAGCAGACTGACGGCATGCACCAGGAGCGCGT
GCAGAACTTCCTCGTCGTGCCGTACAATATCGAGCAACTCTTTGTGTTTGGTGTGTTCCTCGCGCTCGACTCGTTCCTGTACGTGTTCACGTACCTGCCG
CTGCGCATCCTGTTTGCGTGCGGCTGCGCCGTGACGTCGTCGTTCCACACGCGCGTGTTTCGCCGCACGCATTTCTACGATCTCATGGTTGCCGTCATCA
TCTTCGTGGGCACGCTCGTGCTCTGGCGGGTCGACATGTCGCGCGTCTACCACGCGATTCGTGGCCAGGCCATGATCAAGCTCTACGTGCTCTTCACTAT
GATTGAGGTCTGCTTGCGTGTGTAGCTCGTTTGTTTGCACACATTGCCCTAATAACTCTCTCTTCTGTATGCGGTGTGTAGATTTTCGATCGGCTCTTTT
CGTCGCTCGGCCAAGATATCCTCGACTCGCTCTACTACACGGCAAAGTACCAGCCGCGCCGTGTGACGCGCATGTTTCTCGACTTTATGGTCGCGATCAT
CTATGTCGATATCCTCTTTTGCTATTGTTGCCGTGTGAAGTTTGCATATTTTGCCTACATGTTTGCTGCATGGCTTGATGGTTTCTCCTTGACTCCGATG
CACTGCTCCATTCGCTGCTGCTGTTTGCGCAGGTCGTGACGATCAACGTAGCGATCAACTCGAGCAACACGTCGCTCTTGACACTTCTCATTTCCAACAA
CTTTGCCGAACTCAAAGTACGCAACTCGTGCTATTTTTCTTTTCGCTTGTGCTAAACCGTGTGGATATGATGAAAGGCTGATAGTGTTTCATCCGCTGTA
TCATTTGCTCTGTGTGCAGAGTTGCGTGTTCAAGAAATTTGAGGAGCAAAACCTGTTTCAGATCGCGTGCAGCGACATTGTCGAGCGCTTCAAGCTCTTG
CTGATCATTGGGCTCATCCTGCTGCAGTCGAACGCCAAGGACGTGGCCTACGGAACCGTAAGAAGACACGATCAGTCCACCTTCCATAGCTACTGTTGAG
ATTCTCACCTCGTTATGCGTGATTGCTGTCGTTATGTGTCGTCGTTAGACGATGGTGATGACCGCCGAGATGACCATCGACTGGCTCAAGCACGCGTTCA
TCACGAAGTTCAACCAGATCCCGCCGTCGGTGTACTCCAAGTTCATCACGATCCTCTGTCGCGACCTCACGGGCTGGAAGAACGAAGACACGATCCTGGA
CCACACGCACCACGTGTCGAGACGCCTCGGTCTCGTGTCGTTGCCACTCGCGTGCGTCGTGCTGCGCATGGTCATGAAGGCGCTCGCCGACGCGCCGTTC
GAACTCGGGTCCGTGAGTGGCGTGCTCATGACTGTCGCGTTCTTCATGTGCCTCGCGGCGTTCAAGGCGCTGCTGAGTCTCGTGCTCATGATCTACGCGT
GCAAGTCCGGACGACTCGACGACACGCGACCAAAGAGTCCACGCGCGGTCCGCCACCTTGAGTCCATCCAGCGCTACAAGTTTTAA