Transcript Name :
Pytul_DAOMBR144PYU1_G000541
Orientation:
(+)
Number of Exons:
1
Description :
Similar to acrA: Adenylate cyclase%2C terminal-differentiation specific (Dictyostelium discoideum)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-623
NN-scoreoddsWeighted Score
0.5721.4430.003
*** None ***
TypeScore
nuclear696
GO
*** None ***
*** None ***
*** None ***
Sequence
        1872 bases(100 bases per row)
ATGCATCTCCGGTTCCCGCTGCCCGCGGGGTACTTCCCCAAGTTCGAGCTCACGCCGGACGAGACGATGGCGTTTCAGAGCCTTGTGACCGACATCGTGA
AGGAGACGCGCCGCGATCAACTCCACTACGTGCGCGACGGCAAGATGAGCATCGACTCGCGCACGTGGAAACTCGCCAAGTCCAAGGAGCGGCTCCACGT
GTACCGCCGACGCTCGGCAAATGGACCGGGCCAGCTCGGGCTCTACGGCGCGGCGGGCACAAACGAGTCCATGTCGTCGCTCTCGCGCTCGGGCTCCGAG
TCGTCCGTGGACGACCTCTCACGCCGCATGGCGTCCGCCAGCGTCAGCTCCTCGAACCGCGGCAGCTTCAGTTATGACGACGTGTCGCGCAAGTCCATCG
CACCATCGGTGCTGGGCTTTGGACTCATCGAAGGCTCAGTTGATGACATCATCTACGGGCTCCATGAATCGTCCACGGAGGAGATGAAGACCATGGCGTC
GTTCCTGGGCGACGACTCGCTCATCGACTGCGCCGTGCTGCACACGCTGCGCCTGACCAAGTCGACGTACCTGGGACTCAAGTGGAAGCTCACACGTTCG
CTCGGCGGCAATCGCGACGTCTGCTTTGCCGAGTACGTCGGCATTGCGGTCGACTCGCATGGCGAGCGCTACGGTTTCCACGTGCTCGAGTCCGTGCCTG
TGGGCAACTGCCCGCCATTCGCCGACAACTCGATCGTGCGCACCAACATGTCGTTTTGCTATTTATTCCGCGAAAGCTCGCAGCCCGGACTCGTGGACGT
GTTCATGGAGGGCGCGTTCGACTCGACGGCCGACGCGCTGACCGCCGGCGGCGTAGGCGACAACCGCAGCGCCATGGAAATGCTCTTTGGGCTCGACACG
GCATTCCAGGCCGCCGAAGCCAAGAAGCTCTCGTCGCTCGTCGCATTGATGGCCTCGCAGCCCAAGGCCAAGGCCAGCAGCACGCACTGCTCGATCTGCC
GCGCGAAACCGGGTTTGCTCTCGTCTCATCTCACGTGTCAAGGCTGCGGGTGCGTGATCTGCACCAAGTGCCGCGTCAAGAAGCAGACTTTCTCGCGCAA
GGGCAAAATCAAGGTGTCGTGCTGCAAGATCTGTCTCGTGAACGTCAAGGACACGTCGCCGTTCGAAGGCGTCACATTTGAAAAGCAGCCGCTCCAGGCG
CTCCAAAAGAAAAAGTCTGCAGCATCGCTATCGAATGCGCCTTCACGGCCGCCGCTGAGTGGCGGTCACACGGAGAGTCACCAACAGAAGCTGCTGCAGC
GCCACAACTCGAACGGATCCGCGGCGGAGACCGAGTACTCGCAGTCGATGCAGTCGTGGCCCTCGAGCTCCGTGTCGTCGACGTACTCGGACCTCGACGA
CCAATCGTACTACCCAACGCTGCAGCAGACCCCCGAGGAGCACGGCTCGCAAATGGTGCTCATGGACCGCAAACGGATGGCGGCAGCAGATGCCGGTCCA
GGCTACGGCTTCCAGCAACGATCTCAGCACCAACCACCACAGCAGCAACAGCAACTTGCACGGTACGGATCGCAGAACCAGCTCGTGCAGTCGAATCAGC
ACCAGATGCACTACCTGCCTCAGCAGCAGCCAACGACTTCGCACATGACGCCACTCCATGCAGGCTACGCTCCTCCTCCTCAGCAGCAGCAGCAAGGGTA
TGCGCCTCAGCAACAGCACATCGGCGGCGCGTACAGCAACAGCAACAACAACAACCAGACGCGCGCGGGGCTCTACAACCAGATGCTCGAGCTCCAGATG
GCGGCCGAGCGCGCGTATAACATGGCCAACCAGAACGCGACGTACATGCACACGACGCAGCAGCACCGGTAG