Transcript Name :
Pytul_DAOMBR144PYU1_G000558
Orientation:
(-)
Number of Exons:
2
Description :
Similar to SPAC6G9.14: Pumilio domain-containing protein C6G9.14 (Schizosaccharomyces pombe)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1073
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
4556
Sequence
        3318 bases(100 bases per row)
ATGGAATTGGCGTCCCACCACCACCACCACACGGTCGGTGCCGGCGGCAAGCTCGTGAACAGCGGCGCAGCCGTGCCCACGCCGTCGTCGTCGTCCTCGA
GCGTGTCGTCGTCCTCGAGCACGTCCAAGTCGGCGCTGTCGCCTCGCAACAACGAGGACCAGCGACTGCTGCGCACGGTGGACTCGGCGTCGTCCATGAA
CTCGACGGTGTACGAAGAAGACGAGCAGCTCCACCGTCCCGGATCGGCGCCTCCGAATCTCAATTTCGAGTCGTCCAACTTTTTTGCGTTCGGCAACTCG
CACACCTTCTTCTCGAATATGTACGTCCCTTTCTGAGAATGAAAATCTTGTTGTTTTTGGATTTTTTCTGTAGGCAAGTATGCTTATTTATGTCTGTTTA
CTGTGGTTGCTTTTAGGAAATACGACGACGAACTTGCGTCTGGCGAATTCCCCGAAGAAATGTCGTCGCCCACGGGCAACAATGACATTTTGCCTGCCCA
CACGATCTCGCCAACGAACCAGGTGACCCACGACCAGCATTCGGGACCGACCGCTGTTTCGCAAGGTTTCCAAGCGCAGCGCCGGTACACAAGCAACATT
GTGGACACAAAGTCGAGCCATCGCCAAAGCGGGATGCCAAACCATCGCAAGAACAGTATCGAGATGTTTTTGTCGCAGTCGCCAAGTCAATCGCTTGGTG
GCGATTTCCTGAAACTGAGCTTGGACGACCATAAGATGAGTCTGCAGGCGAATGAGCGAGGTGCTGGCGCGTCAAGCAGCGCATTTGCGTCGGGTCACTT
CACGCTGAACCCCGTGCCTGAGTCGCCCAAGAAGTATGGACGTGCGAACTTGGGACTTCGACCTCCGCAACACCAGGAACGGTATGGAGCCGCCGACTTG
CAGCAACCAGTCATGTCGCGCTCCAGCAGCACGAGCAGCTACACAAACTATCAGTTGAGCCCTCGCATGGGCTCGGAGGACTCGTGGCACGGAAGTCAGG
ACGGTGGGCAGCGTGAGCCATCTTCGTATTACCAGGACCACTCCGGTCAAGATTACTATGGCGGTCAGCAATCGCAATATGGCAACATGAGTAGAGAGCA
GCAGTACCACAACCAGCGCCAGGACCACGGCATGTATCGTAGCAGCAACCAAAGCTCGTATGGTGGCGGGTATGCGAATAATGGCCGCAACCAGATGGCG
CAACCGAGCGGTCATTGGAACCCCAACATCGCGGTGCCATCCTCGGGACCAGCGTACAACAATGCAAGCAACGGAATGTACATGAACAACCAAATGCAGC
AACAGCAGATGCACTACCCGTCTGGAGCCCCTGTCGGCAGTATGCGAGGTGGCCATGGCAATCGCGGTGGAAGCAGTCGACACAGCATGGGTAACAGCCA
CGCGTACTCGCGCATGACGCCGCCATTGCCCGAGACTTCACCTCCTCACTCACCTCGCAAGAACATGCAGCTCGGCATGGGACTCGGCGGGGGCAGCTCG
ATGGGGATGATGAAGCAGTGCAAGTTTTTCCTGCAAGGCCACTGCCGAATGGGTGGCAAGTGCAAGTTTGCTCACCAAGCGGTGTCGAACCAACACCACA
TGCCTCAGCACATGGGAGGACCCCAGATGAGCAACAATGGCCTGAATGCCGGTGGAGTGAATGTTGGTATGTACCAACAACCGCTGCAACTGTCTCCGCA
AGCGTCTCGTGGCCTCCCGCACCACCAGTCGATGCAAGGAGGCGACGATCACTTGCACTCGTTTGGTCGTCGAAATGGATACCGACAAGCCGATATGGGC
AACGTGAGCAGTCTCAACACTGGAAGCCTGAATGCGGTCGGCTCGCTGGGCGTTAGCTCGGCGCAAAGCTCTGGTCTTGGCGGAATCAGTGGTTCTGGTT
TGCTGACGCCAAGCGATCCCTCGGGCCTGAGTGCGGCGCTGAGTGTCGAAGACATTCAAGGACGCGTGTTTGCGATGTCGAAAGATCAGAACGGGTGCCG
TCTGCTCCAGGAACAGCTCGATTACGAAGATCGTAAGGATCTGTGTGAAGTGATTTACCAGGAATCTCTGGATCATTTGGCGGAGATGATGGTCGATCCA
TTTGGCAACTACCTGTTTCAGAAGTTGTTGGAACGCGTGAGCGAGAAGAAGCGTTTGGCGATTATTCGCCGTGTGAGCTCGAATTTGGTCGCAGCTGCGC
TGAACCTCCACGGTACGCGATCGGTGCAAAAGGTTGTCGAGGTGTGTGCGACGTCGGCCGAAGTCATCGAAGATGGCATGTACGACGACCTGGACGACGA
TGCTGGCGAGCGACGACCAAATGGAGTGCGTCGAACTGTGAACCTCCCGGATATTATTGTCGAAGCGCTTAAGGACGACGCGGTCCGTTTGTGTATCGAC
TCGAATGGCAACCATGTCATTCAACGTGCCCTGCAATTCATGAAGCCTGAGTACAATCAGTTTGTGTTTGACGCGGTGTGCAAGGAGTGCACGACGGTGG
GCACGCACCGTCACGGTTGCTGCGTGCTGCAGCGCTGTCTGGATGCTGCGAACAAGCAGCAGAAGGCGGAAGTGATTGCGCAAGTGGAGAAGCAAGCCAT
GAAGCTGATGCAAGATCCGTACGGAAACTACGTGGTCCAGTACGTGTTGGATTCGTGCACGGCGGAAGAAGCGTATGGCGTGATCGTGAAGCCGCTCGGC
AACATTTTCGAGCTCTCGATCCAGAAGTTTAGTTCGAATGTGATTGAGAAGTGTCTGGAGAAGGCACCAGAGCGTGTGCGTCAGAACTACATCAAGGAGC
TGATCAATTGCCCCAAGATGAACAAGATGCTCCAGGACCAGTTTGCCAACTACGTGGTGCAACGCGCGCTGTGCGTGTGCTCGGAAGAGCAGTGCCTGCA
GTTGGTCAAGTCGATTCGTCCGCATCTGGCGATGATGAAGAACACTTCGGGTGGGCGACGCATCACGGCGCGCATCTTGAAGCGCTTCCCGAACATGGAC
ATCAGTCTGGATATGGGCTTGTCGCCAACGAGCGACGGCATGTACGACACGAACGGCAATCACATGCAGCTGAGCCACTTGCCGCCGCCAGCATTGGGGT
ACGGTCACCACCACATGCACGCGAGCAACGGGTACCCTCTCGCGCATCCTCAAATGCACGCGCAGCAGCTTCCATCGCACCATGGTGCTGCCGCCATGCA
CTCGCAACAGCACATGGGGTACTCGCAGAGCAACTACAATGGCTCTCAGCACGGGGGTTCCATGATGAACGATGGGAGTGGACTCGGTATGAACGCAGCG
GGCACGAGTCGCGCGTAA