Transcript Name :
Pytul_DAOMBR144PYU1_G000566
Orientation:
(-)
Number of Exons:
2
Description :
Similar to S8: Non-structural protein NS2 (Bluetongue virus 10 (isolate USA))
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-673
NN-scoreoddsWeighted Score
0.5881.6050.003
PositionContextScore
73VPIRSKR|NA0.576
TypeScore
nuclear957
GO
*** None ***
*** None ***
*** None ***
Sequence
        2184 bases(100 bases per row)
ATGAACAACAACAGCAATGCCGTGGCCGCCAAGTCCGTTCCTCCGCGTCTCGCATTCGAAGGCATTACCGTCACAGACGATTCGCGGCATTCGTCGTCAT
CTGTGTCGTCTTGGACAGAAAACCACAGCGTGATTGAGATTTTCACTGAAGAAGAGACGCCCGAGAAGAAAACAAAGCGCAGTAACAAATTGCAGCAGGT
CCCGATTCGGTCCAAGCGCAACGCGCAACGCCCGAGTTGGGCGATGCAGTCTCCGATTCTACAGAAGAAGCCGAAGATCACTGGCAAGAATGCTGTTGCA
GGAGGACCAGCGAGGGGCAAGAAGCGGCGACAACGGCCCGAGTTGGATGCCTCGGCTATTGTACCTGGCGATGGACGACCGTGCGACTTCTGCCACAAGA
CCCAGGGGGTTTGCGCGCTCATGCACTGCGCAGCGTGTCGTCGCGCGTATCACGCCAAGTGCTTTGTGGGCCACTTTCGTCCGCATTGCAAAACACACGC
GACGGCAGAGAGTGAAGATGTCGTTCCGATTGAGCAGCAGATCGCAGCGCTGCAGCTTAATCCACCGGACAATGTCCGCGTCACGATCTTTCGGTGCGGG
CCGTGCCACGCGGCGTTCATTGAGTTCTTCAACAGCGGCGGCTACGAGTGGGACTGCGAGTGTCCGTCGTGCAAAGAGCCCGATAAGCTCATTGCGTACC
GGCGCCAGATGCTGTTGAAGATTATGTTGAATGAAGACGACCCAAAGAAGAAGAGCAAAGGTACAGCAGCAGCAAGAAAGCAGGTAAAATCATCGGAAGA
TATGTATGCGGAAAACGCGCCCCAGGACACCAAGAAGACGGCAGCACGTGGTGGTGGTAGTAGGGCTACTCTTTTGCGACGAACAGGATCGCGACGTCGA
GCAGCGCTCTTGTCGGCTGCAGCTAGCGACGAAAGTGAAGCGATGGTCGTGGATTCTGCTGAAGAGATCGCAGTAGCAACAGTGCAGCTAGCAGAAGCCC
AGGAGCGGAGATCCAAAGCCTTGCGACGAGACGAACACACTGCTAAAGCGAATGAGGACGGTGATGGCGATGGTGCTGGTGACGATGATGCCGAACCAGA
ACAAGAAAATGACATGATCGATAAGGCTGGCGATAGTGCAGAGACTCCTGCTGATGTGGAGCCAAAACCAGAGCTTTCGGAAGACGAGCAGCTGTTGGCG
GCCGTCACAATCAAGTTTGACAGCGGCCGCGACTGCTTTGACATCGTGTGCGTGGTGGACACGAGCACAGGAGAGAGCATAAAGAAAACGGGTCTGTACT
TTGTGAAACAGCGAGAACTGCCGCCCAGGCGTGCCGAACGCGAAGACGTTAACGAAGAAGAAGAGCGTGAGCCCAAGGGCGAGAGCGTGTACTGCTATTG
CTGCAGCAAGGACCTGACGCTGGCGCAATTCGTGCGCCACAGCACGACTCCAACCCCGAGTATTTCGGCTGGGTTCTTTACGGCCAATCCCCTTTTGCCG
GAGGCAGCCGCCGCAATAGCGGATCCGCGCGCATGCCTCTTTGTGTGCCACCACGACGGCATCGGATTGACGCCTTTGGTGAAGTTCTTGAACGTCTTGC
AGAAAAGACAGCGTACTGCTACAACTGCGGTGGGTGGATCGCCGGCCAAGAACAAAATGCAGCGAAAGCCGTCATTGTCAGATACGCTAGCCGAAGCGCG
GCAGACTCTGACCGAAGCCGTGATCTCTCGGCGTTACATGGCCACCAAGTCGCCGCGTAACGTGGCGCAGATGTATGCGATCAAGCTCGTGTGTCTGTCG
AAGAAGCTGATGGTCCAGATGCCCGACAAAGTGATGCAGAGCACGATGGATCCGTCCATGCAGCTCGACTACCCGTACAAGGAAGGGTGGCTCTCGTTTG
ACGCTGGTATCGCCCCTAGGAACGCAGACAGCAAGCCGCCGACGATGTCCACCGTGCAGTGCTCGTGCTGCAAGCAGGATATGGCGCTGGACGCATTCAT
CGTGCACACAAAACTCGAGGACTGGAGCCCAAAGTTCAAGCGCCGATTCGTGCATGTGCCGCAAGTTGGCAACGAACGGAAACTGGTGGAGCTCGAAAAG
ATCTGGCAGGCCGTAATTACGCTGTACCAGCATCGGCGCCTCGACCAGGTCTTGCAGCAAAAGGTCCAAGCCATCGAACGATAA