Transcript Name :
Pytul_DAOMBR144PYU1_G000562
Orientation:
(+)
Number of Exons:
6
Description :
Similar to Dnajc11: DnaJ homolog subfamily C member 11 (Mus musculus)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-637
*** None ***
PositionContextScore
183MFHRGGR|YV0.623
*** None ***
GO
*** None ***
*** None ***
Cluster Id
4555
Sequence
        2240 bases(100 bases per row)
ATGGCGGACGACTCCCACGGCGATGGCGGCGCCGGCGGCGCGGGCGAAGACCCGTTCTGGCGCCAGTTCGAGCGTGACTACTACGCGCTGCTGGGTGTCT
CCCGCGACGCCACGAGTGACGAGATCCGCAGTCGGTACCTGGCACTCTCGCGCGAGTTCCACCCGGACCGTCGCCGCAAGCAGCAGGACGAGGCGCTCAT
CGCGCTCGCAAACACGCAATATCCGATCCTGGATCGCGCCTACAAAGTGCTGTGTGACCCAGTGAAGCGTCGCGTGTACAATCTCTACGGCGAGCGAGTG
CGTATCTCTACTGTATCTGCAAAATATATGTGGCTGCTGTTTGAGAGGCTAATGTGTGCATATTTCGATGTGTGTTGCCCTTGTGATTGTTAAAAGGGCG
TTCAAGCGTTGGAGCAAGATGCGGCGTTGCACAACGTTGTTGGCGCGTATTTGAAGTCGCCCGAAGAGGTTCGTAACATTGCGTTGTCCGTATGCCACGA
GCGTCCACTGACTGGTGATATGTGTTGTAGATGCAACGCCATGTTGAGGATGTGATCCGTCGAATGAACACGCAGGCTCTCGAAGGTCAGTTCTCGTCTT
TCAGCGAGATGTCAATGAACGTGGACGCGTCGGATTTCGTTGCCAACCCTATCCGCGGGTTGCGTAGCATGTTCCACCGTGGTGGACGCTACGTGGAGCG
TACGGAGATGACGATCCACCAGCGCACGATGTTCCCGTTGACCCGCAACTTGAACTTGACGCTCGGCGGATACATGTACGACAAGCATGGGCTTGGCATG
GGCAGCTTTACTACTCAGCTGGCGTATACGTCGTTCGACCCAAGCACCCCCTCGTTCACGGTCTCGAGTGAACTCGGATGGACGCCGAAGCTGCACTGCC
AGATTAGCCAGCCGGTGTCTCCACACACGGTGTTCATGCTAATCCCCGAGTTGGACGACAACGGATTGGATATCTCGTTCGGCGCGAACCAATTGCTCAC
GCCGCAACTTCATGGCGCTATGATGTGGAGCACACGCGACGGGCTTTCGGCTTCGTTGAGTAACGACGCTGGCAACTACCAAGCGACTGCGGCGGTGGCG
GTCAACAAGGGCGGTCCAAACCTCTCGCTCCAGTTCCGCCGTGCGCTGGCAGCGGCGACTTCCGTAAAGCTCTCGCTTCGAGGGAGCCTGTTTGGCGGTT
TGTCCTTGGTCGCAGGTGCGAGTCGCGAGATCTCGAGACGCACGCGGGTTGCGCTTGGTGTACTGCTAGCGAAAACGGGAGTGACGCTGCGTGTTGGTTT
TACGCGGGGCAGTGTCCGCTTTGTGATGCCAATCTTTTTGTCGCCATTCTCTGCGCAGACCGCGTTTTCAACGTTTTGCGCTGCGACGTCGCCATTTCTC
GTGTCGGCAGTGGTGACACAGCTTCTTAAGCCCGCCCAGGAAAAGAAACGTCGTCGTGAGCTTGAGCACCGGCGCGAAATCCGAGTGCAGTACCTCACGA
CGGCGCGCCAGTGCGCGATCGCGCAGCAGAAGCTCATGATGCAATGCGCACAGAAGAAGATGGAGAAGGAAAAGCAGAAAGCAGACAAGAAGGGGCTTGT
CATCTTGGTTGCGCGGTACGGCAAGAACCCAACGAGTCCGGATCCACGTGAGCGTCAGGGAGATACTGCGGACTCGGATGTGCTGTATAGCGGCGGCGGT
GCGGAAAGCGATAGTGAAGATGAGGCACGACGGGGTGAAGGGGCAGATGGCGATCAAGAGGCGGCAGCGGAACTGCTGGAGCAGAAGTGGGTCGATGTCA
CGGTTCCGTTGCAATTTTTCGTCAAGGTGCGTCTCAAGGGTTTGCATGTATCTTCATATGTATAGAATTTTTGGCTGATTGTGTTTGCTCTATGGCATTT
TGTGCAGGATTCGTCGCTTTCGCTCCATGGAACGTCGAAGGCTGGGCTCCTTGGATTTTACAATCCTTGCATCGACCACGACCAGTCTGTTCAAGACACC
CAAGACTTGTCATTTGCAGCTGACAAGCCCAAGCTGTACGTGAGCAATCATTTGGGAAGTACTGTAAATTGTGTACGGTGACGCTGATTGCGCTTTTGTT
TGTTTTGTGTTTTGGTGTACAGGTATGTTCGCTACGCCTATGACGGCAAAGTTTTTGAAGCTACATTTGAAGACGACCAAGTTGTCGACCTCCCATCGCG
CTACGCGCAAGTCATGGGATCTGCTGGGAGTGTGTTTTAA