Transcript Name :
Pytul_DAOMBR144PYU1_G000574
Orientation:
(-)
Number of Exons:
5
Description :
Similar to SPAPJ696.02: SH3 domain-containing protein PJ696.02 (Schizosaccharomyces pombe)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-570
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2252 bases(100 bases per row)
ATGGTCAAGTTCTGCTTCGAGTGCGGCGCCAAGAACAACGGCGGCAAGTTCTGCGCTGAGTGCGGCACGCGCTTCAAGGACGAGTCGGCGGCGAGTGGGG
GCGTGCCGCCGGCCGCGGCCACCGCCGTCGCCAACCAGCTGAACGCGCAGATGCACACGAACGCGTTCAACGGCGGCCATGTGGCAGCCGCGGTGCCCTA
CGCTGCGCAGGCGGCCACGACGTACGGGAAGACAGCGTACCAGCCCTCGGCTGTGGCGACGGCGACGCCCATGGCCGTGCCTGTCGCGACCGGCAGCAGC
TTCTCCGGCAACCGTTCGAATGCGTTTGCAGCAAACAACAACAACAACAGCTTCAACAACGGCAGCGCGCGGCCGTCAGCATTCGCGGCGAACAACAACA
GTTTTAATAATGGCGGCGGACGCCCGTCGGCATTTGCAGCGAGCAACAACAGCAGCTTCAGCGATGGCAACGGCAGCGCACGTGCGTCAGCGTTCCGCGG
CAGCTTCAACAACGGCAACGATGCGCGCAGCAGCTTCAACAACAACAACAACAGCTTCAACGCGCCAAAGAGCGTCGACATGGCGCCCGAGCCCGTGCCG
CCGGCCGCAGTCGGCGCCGAAGCGCAGGAGGTGTACGAAAACTGCGTGCAGACGATCCGCGCGGCGCGCGGCGGCAACAACGAGGCCGGTGTCAAGGCGT
TTAAGCAGAACTGCAAGCTCTTTGGGCTCAAGCAGATCGAGGTCAAGACGTTCCACGACTCGCTCGTGGGCGAACTCGGCGTCGAGGGCGCCGTCGCGTT
CGTGCCGACACTCTCGCGCTTGATCCCCGACGACAACCTGCGCAAGGACCTCATCGAGTACAACGCGACGCAGCGAGGCTTCGTGCCGCCGCCCCCGCCG
CCTCCATACATGAACAGGTACGCTTTTAACGGCAAGTGACTCCATTGCATCTGACATCATCATCAGCTAATGGCGTTTTTTGCTTTGTGGAAACTAGTCG
CGATTCGTCGTCGTCGAGCGGCTCCGAGTACCAGCAGCGCCCGTCGTATGGCGGAGCGCAGGCCGGATCGAGCAAAGGCATCTTGAAGAACCGCTACGGC
GACCACCCGAATTGCGACGTCTGCAACGTCGCCTTTGACGTCACCAAGCGCCGCCACCAATGGTGCGTTGTACTTTGTAAATGCGTTCATTATCTATGGG
GAGTGTATTAACAAAAACTAATGCGCGCATGTGTGTCAAAATGGCATATTATTTCTAGTCGACACTGTGGTATGTACGTGTGCAATTCGTGCTCGCCGAT
CCGCTTGCTGATCCCGCCGGGAAAGCAGTTCGAAGGCGCAAAAGGATACGATCCAGCAGTGCCGCAGCGCGTATGCATCCAGTGCGCGCCACAGCTGCAC
CAATACCAGGACGAGCTGGTGGCCCAGTATGCGCAGTCGCACGAGCAGAATTTGCACGAAGCCAAGGGCGGGATCCACGTGCCGTTCAGCAATTCGCTCT
TGAAGGAGTGCAACACCGCAGCAGATATCATTGGCAACTTTTTCCGAGACGACTGGGGCGCGTCCGCGGATCGCTCCATCCCCGTCGCGTTCTTGCAGCG
TGCGCATGGCCTCGCGATCATGACGATCGTCAAGGCGGGTTTCCTCATCACGGGCAAGATCGGAACGGGGCTCGTCTTCGCCAAACTGCCCGATGGCTCG
TGGTCTGCGCCTTCGGCCATCGGCACGATCGGCCTCGGTGGTGGCTTTGAGATCGGCGGTGAAATCGTCGAAGTTATGATCATTCTCGGCTCGGAACGTG
CCGTGAAGGTGTTCCACAAGCCCCAGGTGAACCTCGGAGCAGGTCTGGACGTCACCGTCGGCCCTTACGGACGATCGGCGCTGGCAGCTGCCGCCGTGAG
CACGAGCGGCCTAAACGCCAACTACAGCTACTCGCAGAGCAAAGGTCTGTACGCGGGCATTTCGCTCCAGGGCGCCGTGATCGCCACGCGATCGGACCTG
AACAGGAAATTCTATGGGCGGGACCTCCAACCAATGGAGATCCTCAGCGGCTACGTGGAGCAGCCGAACGCCGCGCGCCCACTCTACGAAGCCGTCGACC
GCGCCATGCAGGGCATCGAGGATCACCACAACGAAGTCGCGCGCCGCTCGTCCATCATGGGACCCTGCCGCTTGTGCAACTGCCCCATGTTCGTCGCGCA
CACGAAGCAAGTCTGGAACAAGAACTGCAAGACCTGCAAGCATGTGCACTAA