Transcript Name :
Pytul_DAOMBR144PYU1_G000560
Orientation:
(-)
Number of Exons:
2
Description :
Similar to RSPH10B: Radial spoke head 10 homolog B (Bos taurus)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-503
NN-scoreoddsWeighted Score
0.5781.3160.003
*** None ***
TypeScore
cytoplasmic435
GO
*** None ***
*** None ***
*** None ***
Sequence
        1541 bases(100 bases per row)
ATGGCGACAACGGTGGTCTCGAAGAAGCCGCCGCTGGATCCGCGCATCCTGGCGAATGTCGTGCTCGGGTACGAGGGCGAGACGCTACAGCTGCCGTCGC
TCGTGGACGTGCCCGTGTACCACGGCCAGGGGCGACTCGTATTCCGCACGGGGTTCGTGTACACGGGCGCGTTCTCGTTCGGCAGGATGCACGGCAAAGG
CCGCGTCGAGTGGAGCAACGGCGTCGTGTACGAAGGCGACTTTGTCGAGAACGAGATGACTGGTACGGGCCAGTACTTGTGGCCAAACGGCAGCTCGTAC
TGCGGCGACATCGTCGCGGGGAAGCGCCACGGCCACGGCGTGTTTCTCACGGGCACTCGCGGCGTCGTGGACGAGGTGACCAAGGGCGACGATGATAATG
GCGCTCCTCTCGGCAGCTCTACGTCTGCCGAATCCATGGAGATGCTATCTGCACCACTGGATCCGCTGCTGCATTTCACGTTCCATATCCAAGAAGACAA
CCGGGATGGTAGACTAGAGAGTTTTCCTCATATCGCGGCGCAGAGCAACGCGCGGTACGAAGGCGCGTGGCACGAAGGACTCCCGCATGGACTCGGCGTG
CTTGTGTACGACGACGCGAATAATGCGCGCTATGAAGGGCACTTTGTGCACGGCAAGCGTGAGGGTCAGGGTCAGATGCAATACGCGAGCGGCAACTTGT
ACTCAGGCCAGTGGGTAGACGACGCGAAGCACGGCTACGGCGTCATGATGTGGATGGGGAAGCCATCGTCGTCTTTGTACGCGTCTGATCCGCGTCTGCG
TCCTCCGATCGGAGCTGTGGAGTCACTGCCACTGGTGCTGCATGAAGTGTACGAAGGGTACTGGGTGGACGACGTACAACACGGCTTTGGACGCCACATC
TGGCTGTACACGAAGCAAAAGGAGAAGAACTATTATGAGGGTGAGTTTGCAAATGGGCTTCGTCACGGGATCGGCGCATTCCATTATGCGAATGGCTCGC
GCTACGAGGGCGAGTGGAGGGAGAACGTGAAAGAGGGTAACGGGATGTTCTTCTACGAAGATGGACGCGTATTCTACGGCGCGTTCCACCACGACCGATG
TTTGGAGCCCTCGGCGGCGCACTCGATGGAGTCTGCAGGCGTCACTACAAACGCGCAGGCGACTGGCAATAACACCGCGACAACTTCGGCAGCGCCATCG
TCTGCGACTTCGCCAGCGCGCGTCTCGCTGTATATTGACGAACTCTTGCCGCCGGAGAAGGAGGCACGCGAGAAAGCGAAAAAAGCTGTCGAGCACGCAG
CATTACGGCTCAACACAGAGTTGCGTGCTCTGTATCGCCACTACATGAAAGACACCGGTGCTCCTTCCTCGCCCAGTGACACCGATGCATCGCAGGAAAG
CGTCTTCCTCATGGAGATCTTTGAGAGTCGCAAACTACTCTCGGATTGCGGGATCCACATCAACAGCGGCCACGTAGAGCAACTTGTCTGTGAAATCCGC
AGGGCTCAGCGCCAGAGCGCATCTTCTGCAGCGTCCAATAA