Transcript Name :
Pytul_DAOMBR144PYU1_G000569
Orientation:
(+)
Number of Exons:
2
Description :
Similar to clpB: Chaperone protein clpB (Brucella suis)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-775
NN-scoreoddsWeighted Score
0.541.2920.003
*** None ***
TypeScore
mitochondrial783
GO
*** None ***
*** None ***
Cluster Id
416
Sequence
        2428 bases(100 bases per row)
ATGTTGACGCGCGCGTTGCTGGTGCGCGGCGGTCTGGCGCGCAGTCGCCACAGCACGCTGTCTATGGGCGCGTGTCGCGGGCTCGCGTCGCTGGGTGGCC
TCGGCGCGCGGCAGCCGTGGGTCAACCCCGAAAACGTGCCGCAGGGCGAGAGCCTCAAGTTGTACGGCCGCGACCTGACGGAGATCGCGCGCAACGGCAA
GCTGGACCCCGTGATCGGTCGCGAGGAGCAGATCCGCCGTGCCGTGCAGATCCTGTCGCGACGAACCAAGAACAACCCCGTGCTCATCGGCGAGCCGGGT
GTCGGCAAGACCGCGATCGCCGAGGGACTCGCGCAGCGCATTGCCAATGGTACGTGGTGTAGTGGCGCATATCCATGCGTGCTGCTGCTTATTTCTAACG
GTGTTGCATCTCCCATGTGGTTGCTTGTTTGATTGTTGTGCGTTTATAGGGGAAGTTCCGGAGAGCATCAAGAACAAACGTGTTGTATCACTGGACCTCG
CCGCATTGGTCGCTGGCGCCAAGTTCCGCGGCGAATTCGAGGAGCGCTTGAAGGCCGTGCTGAAGGACGTGGACGAGAGCCGCGGCGAAGTCATTCTCTT
CATCGACGAACTACACACCCTTGTAGGTGCCGGTGGCAGTGAGGGCTCGACGGATGCGGCCAATATGCTCAAGCCTGCGCTCGCACGAGGCACGTTGCAC
TGCATGGGCGCGACGACCCTGGACGAATACCGCAAGTACATCGAGAAAGATGCAGCATTGGCGCGGCGGTTCCAGTCGGTGCTCGTGCCCGAGCCGAGCG
TCGAAGACTCGATCACAATCCTGCGCGGCCTCAAGGAAAAGTACGAAGTGCACCATGGTGTTCGCATCACGGACAATGCGCTGGTCGCTGCAGCGACGCT
CGCGAATCGGTACCTGACGGAACGCAAGATGCCGGACAAAGCGATTGACTTGATGGACGAAGCGGCGTCCCGTCTTCGATTGCAGCAGGAGAGCAAACCC
GAACCGATCGACAAACTCGACCGTGAGATCATCCTGCGCCGCATTGAGATTGAAGCCTTGCGCAAAGAAACGGATGCTGCTTCCAAGAAGCGCATGGCGC
AATTGGAGAAAGAGGTTGAGAGTGCATCGCAAGAGTTGAAGGTGCTCATGGACGAGTGGAACGCCGAGAAAGAAAAGCTGGAGGCGATGCAAGACGCAAA
GCGGAAGCTCGAAGAAGCGCGGCGCGAACTCACGACGGCACAAAACAACGGCAACTACGCGCGTGCCGGTGAACTCTTGCATGCGATTATTCCGAAACTC
GAATTGCTGGTCGCAGAAGAAGAAAAGGAGAAAGAGGCGTCTGCGAGTGGTGCGGCCGGTCCGATTGACGATGAGCACAAGAAAGTGAAGTCGATCTTGA
GCGATGCAGTCACTGCGGACCACGTTGCCGAAGTCGTCGCGCAGGCAACGGGTATCCCAGCATCGACGTTGATGGCGGGCGAGAAGCAGCGCTTGCTGAA
GATGGAAGACTACCTCAACCACCGCGTGATCGGACAGAGTGAGGCGGTGCAGGCAGTGAGCAACTGCGTTCGCTTGGCGCGCGCGGGTCTGCATGCGCAC
AACCGTCCGCTCGGCGTGTTTATGTTTTTGGGTCCAACCGGCGTGGGGAAAACGGAACTCACCAAGTCATTGTCGGAGTTTTTGTTCCAGTCCCCGCAGG
CTCTGACGCGCATCGATATGTCCGAGTACATGGAGAAGTTCAGCGTGAGTCGACTGGTTGGCGCGCCTCCAGGGTACATTGGATACGAAGAAGGCGGTAC
GCTGACGGAAGCTGTGCGCCGCCGTCCGTACCAAGTCGTGCTATTTGACGAATTCGAGAAAGCGCATCGCGACGTGTCCAATATCCTGTTGCAAGTGCTC
GACGAAGGTCGACTCACGGACTCCCAGGGCCGTCTCGTCGATTTCCGCAACACGGTGATCATCTTGACGAGCAACTTGGGTTCTGATGTCCTCGCGGGTC
TACCCGAAGGGATGCCGAGCTCTGTCGCAGAGACCGAGGTGCTCAGTGCCGTGCGTGGCCACTACGCGCCGGAATTCCTGAACCGCATCGATGAGCTCGT
GCTTTTCAACCGTTTGGACCGGGAAGCAACGCGCTCGATCGTGGACCTGCAGTTGGAGCAAGTGGACAAACTCTTGGAAGAGAAAGAGATTCAAGTGGAA
ATCGATCCCGAGGCCAAGGAGTGGCTCGCGGCCGCGGGGTACAGCCCGCACTATGGTGCGCGTCCGCTCAAGCGGCTGATTCAGCATGAACTCCTCAACC
CAATGGCAGTCAAGCTGCTCGAGGGATCCGTGAGTGCAGGCCAGACGATGCGCGTGCGAATGAATCCCAACTATGAGGAAGAACTCGTGAAGGAACCTCG
TCGCGCGAGGCCGTTGCGCATCGACTAA