Transcript Name :
Pytul_DAOMBR144PYU1_G000556
Orientation:
(+)
Number of Exons:
1
Description :
Similar to rnf126-A: RING finger protein 126-A (Xenopus laevis)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-310
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        933 bases(100 bases per row)
ATGGCGGAGGAGACGGACCACGCTCTTCATCCTGTGGTGCCCAAGAAATCGACGGAGCGGCGGCTGCGCAAGATGAGCCAGGACTACCCGCCCACGACGT
TCTCGTTCCACGTGCAGGCGCGCGTGCTGTGCGTCGGTATGGCCGTCGTGTATCGCGTCGCGATCACGATTACGACGCGCACGACGTGCGTACTCGCGCC
GCAGAATACGGCAGCAGTAGCGGCATCGCAGGGCGCGGGCGCATCGTGTCAGTCGTGGGTCATCGCCATGAGTCAGGCCAAGTTCCACACGTTCTTTTCG
CAGATCCGCGCGATTTTGGAGCAGCCGGCAGTAAACCAGTACCGCGAGCGAGATGACAGCGAGTGGAAGCCCTTTGAGCGCTTCCTGCAGACGCTCACGG
ACGTGCTCGACCAGTACGAGCACCTGCAGTCGCGCGCGTTTGCGATCAACGCGAATGTCGACGCCATGAACGAGGGCAAAGTCGCGCTCGAGGGCTTCCT
GACCGATTGCTGGAGTGCGCTAGAGATCATCATCCCGTCGCTCGCCGTGGAGCCGCATTTCCCGGCCTCGCTGGGCCGCGAAATCCTCTGCATCTACGTG
CTCATGCGTGATTTCCTCGCGTTCCCCGAGTGCATCTTGGAGGGCAACTGGATCTACGCGAATGCGATCCTGAGCCTCGAAGATGTCGAAGAACTGCTGC
CGACGCTCTCGGAGCACGCGTGCAGCATCTGCCTCGAGCGCCTGCGGTTCACCGACACGCGCGATCTGGATCCAGCGTCGGCCAATAGCGAGTCCGAGAC
AGCAGCTCCCGCCGAGAGCACGTTCTCGGTCAAGCTGCCGTGCGCGCATTTGTTCCACGAGAACTGCATCATGGCATGGCTGCGCCACAACCCGACGTGT
CCCGAGTGCCGCGCCGTCGTCGGAGCGAAATGA