Transcript Name :
Pytul_DAOMBR144PYU1_G000543
Orientation:
(+)
Number of Exons:
5
Description :
Similar to CREG1: Protein CREG1 (Gallus gallus)
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.740.81827
InsideOutsideTMhelix
25-232
1-4
5-24
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1026 bases(100 bases per row)
ATGAAGAAGAACGCGACGACGCTGCATCTGCTGCTGACGGCGCTGCTGGTGCTGCTCGCTTGCAGTGCGTGCGACGCGCGCCGCAGCTACATGCGTCACT
CGGTCATGATCCTCTCCAGTGTCACGCCGTCCACTGCGTAAGTCCATGTGCACATGTAAATGCGTACGTGTGTGCTTTCTGTATTGACTGATGTACTGTT
GATTTAATGCACTCAGAGCCCTCCATGCGCGTCAGTTGGTGCATGAGAACGAGTGGGGGACGCTCGCGACCATTTCCAAGCAGTTTAACGGCGTCCCGTT
TGCCAACATCGTCTCGTACAGCGGTGGGTTTTACTGAGCGTAGCTCCTTCACGGGACCAGTATGTACAACCTTATACTAACAGCTTTGCTAATATGCTAT
TGTAGATGGCGTGGGCGACTCGGCGGAAGCGGCCACGGGCGAAATGTTCTTTTACCTCACGCCCATGGACTCCACTGGTGCGTTTAGACTATAATCCAAA
CGGCAATATCGTATGATAAAAAAAGAAGCTGACGCTGCTTATTGTTATTATTTGTTATAATAGCGAGCGACCTGGCGGTGAACCCAAGCGCGAGCGTGTC
GATCTCGATGGCGCAGGGCGGCAAGGGCGCCTGCAAGATGGACGTTGAGGACCCGACGTGCTGGAAGCTCTCGTTCACCGGCACCGTCGTGCCCGTGCCT
GCGGACAAGGAGGAGTACGCCAAGAAGGCGCTGTTCTCCAAGTACGTCCCTATAAATTTGTATACCTCGTATGCTAAAATGGCTGTGGCTAATGAAGAAA
AACTGCTGTTTGTTTATGTAGGCACCCCCAGATGAAGTACTGGCCGAGCGACCACGGCTTCAAGCCGTACGTGCTCAAGCCCGAGAACATCGTGCTCCTG
GACTACTACGGCGGCGCCAAGCACATCCCCGTGGACGAGTACTACAGCGTCAAGCTGAGCGACGAGAGCGACGACGACATGGAGCAGCGCTTCCGCATCC
CAGAGTACTACCGCATCAAGCACTAA