Transcript Name :
Pytul_DAOMBR144PYU1_G000545
Orientation:
(-)
Number of Exons:
1
Description :
Similar to UPF0631 protein HSD24 homolog (Bos taurus)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-115
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        348 bases(100 bases per row)
ATGGCGTCCACGAAGCAGCAGGTGCTGCAGCTCTACCGCGAGTTGCTGCGCGTCGCGCGCGCGTTTCCCGAGCGCAGCATGGGTGCCAAGCTGCAGTACA
ACACGCGCGAGTTGATCCGCCTGCGTCGCGACGAGACGAGCGCCACCAAGATCGCGCAGTTCCTCCAGGAAGGCCGCGACACGCTGCGCATGTACCAGCT
GCTCCAAGAGGAGCCGAGCGTGCTGACGGCGATCACGCGCAAAAACGAGCAGAAGGCCGCCGAGAAGGAGCGCGAGCGCGAGTTCGTGCGTCGCGCCACG
CAGTTCCACCAGCAGCCGGCGTCGCAGCACACACAGCGCGCCGAGTAA