Transcript Name :
Pytul_DAOMBR144PYU1_G000553
Orientation:
(+)
Number of Exons:
1
Description :
Similar to DSPP: Dentin sialophosphoprotein (Homo sapiens)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-919
NN-scoreoddsWeighted Score
0.551.3850.003
PositionContextScore
402NSTRPSR|SS0.52
TypeScore
nuclear957
GO
*** None ***
*** None ***
*** None ***
Sequence
        2760 bases(100 bases per row)
ATGAGCAGCGCCAGCAGCAGCAGCAGCAGCGCCGGCAATGCGCTCGCGTTCCCGCTGTACCAGGGCTTCTTCCCGCAGCTCGTGCTCAGCGTGGACGAAC
TCATCGCGTACCGGCGCCTAGGCAAGGAGCGCGTGAGCCAGCTCGTGCGTATCATCGAGGACGCCGACTGCGTGTACAACTGGGTGGACGTCAAGACGCG
GCCGAACGGCGCGCGCGGCAGCGTGGCGTGCCAAAAAGCGCAGTGCGTCGACATCCGCCCCGCCACCAAGGCGCCCCACGCGTCCACGTTTGTGAAGTCG
AGCGTGCACATCGTCGACGTGCAGCCCGAGGAGCTGCTCACGGCGCTCGCGCGCGCCAAGACCAAGGAGTTCCGCAAGGCCATGGCGTACTTGCATGGTG
AGAGCTTTGTGGACGCGCAGACGCTGCTGACGTTCCCGACCTCCGCGACGTCGACGAAACCCGCGTACTCGTATCGAGCGATTAAATGGTACGCGCTGAA
GGAGAAGCATCGCAGCGGTGATGCGTCGTCCAAGAAGAAGAAGACGCTCGATTTCTGCGTCTTGGAGTACGCTGGACGCAAGAAAGCGCATCCAGGATCC
GACGTCCTCGGCTTCATTGTTCAGGAATCGCTGCCAGCGGAGCGCGAAGTGCCGCATCTGGACGCGTATGGCATCCTGCGCGGCCACGTGACGCGCACAG
GCATCATCATCTCGCGAACGCACCAGTCGAATATCCTTAAAGTAACCTCGATTTGCCAGATCGACGGCGCTCTTAGTGGCGCAATACGCACGGCAATGGA
CGAGATCATGCTCGAAAGCGTCGCGGCGATCCACCGTGTGAAAGGGCTGCTCGAACGTCAGCGAATGGGCAAGTTGCAGTACCTGGAGGAGTGGGAGTGG
GTCGCGAATTCCGAGCGCAAGGCGTGCGCCGTGTGTCTCCGAGGCTTCTACTTCCATCGCAAGCACCACTGCCAGACGTGTGGCGAAGTGGTGTGCTCGA
GCTGTGCGCCGCTGCGCGAACTCGACGAGCCGCTGTTCGATACGATGCAGATCCGCGTCTGCACCGTGTGCCTGGCGAGCGTCGGCAGCCAGGCTGCTGC
GAGCACCGAGCGCACGTCGTCGAATGGCGGCACGAACACGTACATCCAAGAGCTCCAGCGACCTAGTCATCAGCACCATAGTTATAATTCTACGAGACCC
TCGCGTTCCTCGGAGGAGTCCCGCGTCCCGATGCCTCGGCATCGCATGAGCAACCTGAGCGACGAACAGCAGCACGCTGCGGGACGACGGAGCGATCTCT
TTGATCCGCGGCGCGTGAGCCACGGGTCATCGTCGTCGGCGTCTCGTGGTGGCAAAAAGACGGAGACGCTGAGCAAGCTGGCGTATCACATCCAGCAGAT
CCGCGAGACCATCAACGTCGCGATCTCGGAGGTGGACCAGTCCGCGAACAACAACAAGTCCTTTGACGACGTGTACGAGCGGATTCTGCAGATCCGGGAG
ACGTTGGACATCTCGGGCTCGGAGTTTGACGCCGTTCTGGCGTCGATCGCGAGCGGAGACAGAGGAGGAGGATCCCGCCGCTCGGACGTCGACGACTCGG
ACTACCACTACTCGAGCAGCATGGACCGCGAGAGTCTGTACTCGTCCGAGGGCGCGCGCTCGTCGTTCTCGCAGTCTTCTCTTGGGAACAGCAGCAGCAC
GATGGGCAGCGACGCCTTGTTGCTCGATGCGGAGCCAGCGGAGGACGACCACCATCGGTCTTCATTGACGTCGTCGTCACTTCTTCGCCATGGCCGTTCG
CCGATGCACAAGGACTCGCGGTTCTCGGACCAGACCGTCGCGTCGAGCGCGTCGAAGCAGAGCTCCGAGCTGAAGCACCGCCAGCCGTTTGTCGGGAAGT
CGGTGAAGTCCGAGTACGCGCCCGTCGTGTCGGTGAACCAAGCGCGCGGCATCCACCGCCTCGCACAGAAGATCGAGAAGCTGCAGCAGCGCTTGGAAGA
CTCGCACCGCGCGGCGTCGGTCGTCGACGTGAGCGATCTGGAGTCCGAACCGGAGCCAGATGCGCGGTCCGAGGCGTCAATGCAGCCACGCCGACGACCG
TCAATGGCGTCAGGACGCCCCCCGCTGTCGGAGAACTCGCGGATCACGGCCGAGATGGTTGAGGCGCTTCGTGGCGTCATGGCGTCGAGCGAACTCACGA
AACCTCCCGCTTGGCGCAAATCGTTCTCGTCCAGCGGCCACACCACCCATCCGCACAACAACGACGCGGCATCGATCGGGTCACGCGCATCGTCGTCTCG
CCATGGAGCTGCGTCCTCGGGCGGCGGTAGTACGACGATGTTTGTGTACGACGAAGACAGTGTGACGCACAAGTTCCAGCGCGTGAGTGTCGAGAAGCCC
GGGCCGCGAGACAAGTTTCAAGCAGACGACGAGGATGTGATCTCGCTGTCCTCGTCCGAGGGCCCGTTCTCTCTGGCGATGCGCGGCAGAGACGGCTCGG
AGTATCTCTACGAGTCGTCGCTGTCGTCGGAGCGGAGCCTCGAGGAAGACGTGGCGTCGCTGCCGTCCTCAGACTACTACACGTCCAAGAAGCCGAGCTA
CTATGCGAACGGCAAGCCCACGACTGCGAGTAGTTACTCGGACGAGAGCGACGACGACCTGCGCGGCCTGCTCGAGGACCTGCACAAGCTGCCGGCGCGC
ATGCGCACGTCGAGCGGCCAGTCGAGCGGCGCGCCGTCGCAGGAGAACTACAACGTCTGA