Transcript Name :
Pytul_DAOMBR144PYU1_G000548
Orientation:
(-)
Number of Exons:
1
Description :
related to b-1%2C3-glucan synthases
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-267
387-397
475-494
1297-1368
1498-1579
291-363
421-454
518-1273
1392-1474
1603-1611
268-290
364-386
398-420
455-474
495-517
1274-1296
1369-1391
1475-1497
1580-1602
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
29
Sequence
        4833 bases(100 bases per row)
CTCGATGCCGATCGGCGGCGCAACAACTCGGGCCGCACGGAGCGCTTCAGCACACGGCTCACGGGGCTCGATGTGAACGGCTCGCAGCCGCCCAGCAGCA
ACGGCAAGAGCTACGGCAAGGACAGCGATGCGTACGCGGCCGACGACGAGGAAGCATCCATCGACTTTTGCTGCGAGCTCCTGCGCAGTAAGTTTGGCTT
CCAGGAAGGCTCGGTGTCGAACCAGCGCGAGCACGTGCTGCTGCTGCTCGCGAACGGCAAGGCTCGCTCCAAGCCGTCCGATGTGCCCGACCATCATATC
ATCGAGCTCCACAAGAAACTGTTTGGGAACTACCGTGACTGGTGCAAGTTCTTGAAAGCGCAGCCCGTGCACTTTCGTGCGTCTGCGGGCGGCAAACTCA
AGCATCCGCTGCACATGGACATGATGCTGTATTTCCTGATCTGGGGTGAAGCTGGGAACCTGCGGCACATGCCCGAGTGTCTCTGCTACCTGTACCACCA
GATGATGGAGGCGACCAACGCCGACACTAATGTCCAAGACACCAAGCCTGAGGGCTGGTACCTGACGAACGTCGTCCGCCCGATCTGGAGTGAATGCAGC
AACATGCAGCGCCGCAACCAGCTGAAGAAGCCGTTGGAACACGTGCAGATTCGCAACTACGACGATATCAACGAGTACTTTTGGAAGCAGCACTGTCTGA
GCATCGATATCACGAACGTCGGACGCGAGTTGTCGCAGAACCACGGCAAGACGTTCTATGAGCACCGTAGTATCTTCACGCTCGTGCTCAACTACTACCG
CATTTTCCAGTTCAACCTCATGTTCCTGGTCCTGCTCGTCGTGCTGGCCTTTGCAGTCACGATCTCGCCCGATGGCGGCAAGGACTGGTTTACGCAGTTT
GGCCGCATCGGCGACGTTGTGGAGCCGTACCACACGCGCGACCTGAAGCTCGCAGTCGTGGCGATCGTGTTTTCCCATGCTTGTCTCTGTTTGTTCAAGT
GTGTGCTGGAAGCGTGCCACGGCTGGCATTTGCTGATCGCCAAGGAATCGTCGGCGTCGTCGTCGCGATCGCTCACTTATGGTTCGGCGCTCGTGGTTCG
AATGCTCTGGAACGGTGGCTTCGCGGTGCTCTTTGGACTTATGATTTTCGTGCCATTGAACGAAGAGCGCGACACGGCGTTGTTGGACCAGTTCCTTCCT
GTGGCTGGCGCTTTCATCCTTCCTGGTCTGCTCGTGCTCCTGGTCCAAGCGTTTTCGCCGCAGCTGATTTCTGGCACGTTTGCGTCCAAGTTTGTGCGTG
AAGGCGAGTCCTGCTACGTTGGGCAAAACATGACACCGCCACTTTCGTACCAGATCAAGTACATTATCTTTTGGCTGGTGTTGTGGGCGCTGAAGGCTCT
TGTGTCGTACTTTATCCTGATCCGCCCGCTGATGCTGCCATCGCTCGCGATTTACACGATGAAGCTTGATTACCAGAGTTCGTTAGTGTCGTTCCACAAC
TTGGGCGTCATCTTGTCGCTCTGGTTGCCAGTGGTGTTCATTTTCAACTATGATACGCAGATCTACTTTACGATCTTCCAGGCGTTGCTGGGTGCGTTCA
AGGGCGTGCTCATGAAAACGGGTGAAATTCGCGGCGTCAAGGAAATGTCCAAGGCGTTCCGTGTCGCGCCACAACTTTTTGACCAGAAGGTTGTGACGAC
CATGGCGCGTGCGAGCGACGCGTCGGCGAACGGAAACGATTCGTCGCGTCCAAGTGCGTTGGCGGCGGCGTACGAGTCGCAGATGATGCTTCGTTTCGTT
GTCGTGTGGAATGAAATCGTGAACTCGTTCCGCGAAGGCGATTTGCTGGACGACAAGGAAGCCGCGATTCTGCAATACGACATCCGTAGCAACGGCGAAG
TGTTCGAACCGGTTTTTTTGTCGGCGGGTAAACTCGGTGAAGCCATGAGCCTGACAGTCAAGACTGCGAAGGAAGGCAAGGGCGAGTCGCAGTTGCGCGT
CGCGTTGGTGGAAAGCGATTGCCTTTCTGCGCTTCGCAGTTTCTATACGGCGAGTTTCTACGTGTTGACGTCGCTTTTCGGCAACGATGATGCCGATGTC
ATGGATGGTTTCCGTATGATCGAAGACATTGCGTCGGCCGGTGGATTCATGAAATCGTTCAATGTGCGTGAGCTCGTGCGTCTTCGTGCCGCTGTCGTTG
ATCTTTTGGAAGAAATCTTGGAATTGCCAGACCCTGATGTGCAGTCGCAGCACATGCCAGGTGCCCGTGTGCACACGATGGGTGTTGTCCGCAACTTTGT
GAGCAAGATGGAAGTGTTTTTGAACATCCTGCAAGCGTTCTGCGTCGACCCGGTGCTGCAAAGCAAGTTCAGAAACTCGAAGTTCTGCTCGAGCACGAAC
GGGTACATGTACGCGTCGCGCGGTCTTGTGAACTTGTTTTGCAGCGATAGTGCCATGGGTGCGGCGACGCGTGCGTGCCTGTTGTTGTCTTTGGAACGCT
CGGAGGCGATGCCGCGCTGTACCGAAGCGCAGCGTCGTTTGGGCTTTTTCATGAAGTCGCTTGTCATGGATATTCCTCAATTGCAAGCGATCAAGGAAAT
GCGCTCGTTCTCGGTCGTGACGCCATTTTACGCGGAGACGGTGCTGTTTTCGCTCGAGGATCTCAACAACCCGCTCGTCAATCACCCGATTTTCGAAAAG
GCCGAAGAAGATGGCAAGAACTTGACGATTTTGAAGTACCTGACCAAGATTCACGAAGAAGAATGGTTGAACTTCTTGGAACGTATGGATGTGAGCTCGC
CAGAAGAAGCGCAGAAGCAATTCCCACTCGATATCCGTCTTTGGGCCTCGTACCGTGGTCAGACGCTTGCGCGTACGGTGCAAGGTATGATGATGTACGA
AGATGCGATCAAGATTTTGCACTGGTTGGAAATTGGCTCAAGTCCTGGTAAAACCGCGGAACAGAAGCAGACGCAGCTGCAAGATATGGTGCGTCTCAAA
TTCTCGTACATTTGTGCGTGTCAAGTGTATGGCAAGCACCGCCGCGAGAACAAGCAGCAAGCTGATGACATTGATTACTTGCTGCAAGAATACCCGAACT
TGCGTGTTGCGTACGTTGACACGATTGATATGGCGAACGGAGAGAAAATGTATGATACGGTGCTCATCAAGAGCGAAAATGGTGAAATTTGTGAAGTCTA
CCGGTACCAGTTGCCTGGCGACCCGATTTTAGGTGAAGGCAAGCCAGAAAACCAGAACAATGGGGTGCAATTTACTCGCGGTGAGTTTGTGCAAACGATT
GATATGAACCAGCAGCACTACTTTGAAGAATGTCTGAAGATGCCGCAGATGCTTCGCACGGCGGATCTCCACCCGTCGAAGAAACCGGTCTCGATTATTG
GTATGCGTGAGCACATTTTCACGGGTAACGCATCGTCGTTGGCGAAGTTCAAGACGTGGCAAGAATTGGTGTTTGTAACGCTTTCGCAGCGTGTGTTGGC
GGAACCGCTGTACGTGCGTATGCACTACGGCCACCCAGATGTTTTCGATAAGGTGATTGCGCTGACCCGTGGTGGTTTGTCGAAGGCGAGTAAGGGCATC
AACTTGTCGGAAGATGTGTTTGCTGGTTTCAACTCGACGCTTCGTGGCGGTGTGGTCACGCACGTAGAGTTTATGCAATGCGGGAAAGGTCGTGATGTGG
CGCTGTCGCAGATTTCGATGTTTGAAGGCAAGTTGGCAAATGGTGCAGGCGAAACGTCGCTCGCTCGTGAAGCGCATCGCATGGGTCAATTTATGGATTT
CTTCCGTCTGAACTCGATGTACTACTCGCACACCGGTTTCTACTTCGCGACGTGGATGACAATTGTGACGACGTTTGTGTACATGTACAGCAAGGTGTAC
ATGGCGCTCGCGGGCGTGCAAAAGCAAGTGATTTTCAAGATGGAATCGCAAGATATCATCAACTTGAACGAAGACCTGAACTTTGCCGATCGCGCGTACG
ACGACGCGGACTCGGTGATCAATACGCAGTATTATATCCAGGCTGGTCTGTTTTTGTCGTTGCCGCTGATCGCTGTGTACTTTGGTGAAATGGGTCTTCG
ACGCGGGTTTGTGCAGTTTATCGAAATGGTCGTGACTGGTGGCCCTGCGTTTTTCATCTTCCAGGTCGGAACGACGATGCACTACTTTGACAACAACTTG
CTGCACGGCGAAGCGCAGTACAAGGCAACGGGTCGTGGCTTTAAGATCACACGAGAAACGTTTGTGTTGTTATACAAGGCTTACGCAAACAGTCACTACC
GGAAGGCGTTTGAACTCGTGGGTCTTTGCTTGGTGTACGTGACCTTCGGTGAGTTCAACATCTGTCGCCGCGATGGTCCAATTACAGAGAGCCTGTCGAG
CGATTTCTGTGAGACCGCGCAGGGCTTTGGCGTGCAAACCTTTGCGATTTGGACGATTTCCGTGCTCTGGCTCATGTCGCCGTACATTTTCAACACGGAT
GGTCTCGATTGGGAAAAGACGAAGGCCGATATCAAGGCGTGGACCGTGTGGATGTATGCTGATGAGTCGTTTGTGGACGAAGACCAGCCTATGTGTGGTG
GCTGGATCAGCTGGTGGAAGAGCGAGCTCAGCTTGTTCCACAACACGCGCCCAATTGCTCGCTTCACGGTAATTTTGCGCGAGAGTCGTCACTTTTTGCT
GATGTGGTACGTGATCACGTTGCGTTGGAACGCGACTGCGGTCGCGCTTGTGCTCGGTGCTGTTGTCGTGACGGTGATTCTGCTTGGCGTCCTTGGAGCT
GCAGGAAGCACGCTGCGCGGCAGCCCTGCGCCT