Transcript Name :
Pytul_DAOMBR144PYU1_G000557
Orientation:
(+)
Number of Exons:
2
Description :
Similar to Zdhhc16: Probable palmitoyltransferase ZDHHC16 (Mus musculus)
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.3930.64327
InsideOutsideTMhelix
28-38
152-184
1-4
62-128
208-292
5-27
39-61
129-151
185-207
NN-scoreoddsWeighted Score
0.7284.3220.009
*** None ***
TypeScore
endoplasmic reticulum444
GO
*** None ***
*** None ***
*** None ***
Sequence
        946 bases(100 bases per row)
ATGGACATTGGTCCGCTCTTCGTGGGCGTGGGCTACTTCCTGCTCGTGGCCCTCGGTTGCGTGCACTTTGTGCTCTTCCTGCCGCTGCATACAGCGTCTT
CATCGCGGGCGACGTGGTCTGGTGTCCACTATGGCGTGAGCATGTTGCTCATGGCGCAGCTGCTGCTACAGTACTCGCTCGCCGTGTGGTCCAATCCAGG
CTACGTCACCTTTATTCCAGCAACACGAGCCCCCGCCACTGATGCAGCATACGATGGCGATACCTGCAAGAAATGCGCGCATGTGAAGCCCGAGCGGGCG
CACCATTGCCGCGTGTGTCGCACGTGCGTGCTCGAGATGGACCACCACTGTCCGTGGATCAACAACTGCGTCGGCTTGTACAACTACAGTGAGTTCATTG
TCGTTCTGCTCCCACGTGTTTCATTTGTTGATCATTTGCTGTGTATGATCCGTAGGATTCTTTTGGCTGCTGCTCATGTACCTGTGGATCAGTTGCATGT
ACGCGTCGAGCATCTCGTGGGAGCCATTTCGACACGTGCTGCATACGCAAAGACTCAAGTATTATAATCGCAACAGCAGCAATGTGTTCGCTCAGGATCT
TGCACAGCGACTGCAAAACGTGCTGATCTTGTTTTCGTTCTTGGTCACGAGTACGCTGGGCGTCGTGCTGTTCGGGTACTGGACATGGCATTTCTACCTC
GTGTTCTCGCAGCAAACGACGATCGAGTTTGCGATTCGTCGATCACGTTCCAAAGAGAAACGGCATGGTGCTGCATTTGGAGCGTCGCAGTTGTGTGGAC
GTCGGCAATCGCTGCTGCGAAACTTTCAGCGCATGCTCGGGAGACATGACACGTGGTGGTTCATCGCACTCGTTCTGCCATTGCCACAGAGGGATTTTGC
GAGTTCGCGAGAAGCTGGTGCTAGTGACGCATTGGAATCTGTGTAA