Transcript Name :
Pytul_DAOMBR144PYU1_G000538
Orientation:
(-)
Number of Exons:
1
Description :
Similar to ESAG8: Putative adenylate cyclase regulatory protein (Trypanosoma brucei brucei)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-650
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1953 bases(100 bases per row)
ATGAACACCAATCACCTGCAAGATGTCTTCCCAGTGGAGCTGTGGAACGCCGTCCTCATCGACTTCTTGACGCTCAACGAAGCCGTGGCGTTGGCTGAAC
TGAATCGCTTCTTTTACAGACTTGTGCACACTCAAGTCGACTTGCGAATGGAAGCACTTCTCGTGACAAGCGTGCGTGAATTGGTGCGCGTGCAAACATT
GTGGTCGAACCTGAAGAACGTGTCCTTCCAGCCTCTTCCCGAGAAGATGATGAAACGTGCCGCGGACGAGAACATCCACAACAACGTGCACAACCCAGGT
CTATTAACAATTGAACATGGCGATGGTGATGATGAAGATGAGGTATCGATGATTGCTCATGAAGAAGGCCACTCGACCTCAAGTCACGGCTACGTCTGTT
CGTCAGAACTGGAGTCTGCGATCCGAGAGAGACGCATTCAAAATCTCAATCTCTCTGGGTTCACTCGCGTGCACTTATTCGATGGCATCAACCGGCTCCA
GGCTCTTGATCTCAATGGCTGCGTTCGCATTGACGGACTTCACTTTCTCAATGGGATCTCTCACGTTGATATGAGTTATTGCAGCAACCTCGTCGACATC
TCGTTCCTATCGAGCACGAAAAGCGTGGATCTCTCGTACTGCCACGAGATCTCAAACCTTGGGCCTCTTTGGCACTGTGAATCCGTGCAGCTCAACGTTT
GCCGAGGGCTCACGGACGTACGTGCTCTCGCAAATGTCCGGCAAGTCAGTCTGCGCAATTGTCCTCAGCTTCGAGATGTGTCTGCGCTGAAGAACGTGTA
CGATCTGAACCTTGGCGGATGCATTGATCTCCGAGATGTTCGCAGCCTTGGGAATGTACACACGCTGTGTCTCTCAGGATGCATCAATATCACAGACGTC
AGCGCCTTGGGCTCGGTCCACACGCTGAAGCTTCGGAAGTGCCTGGGTGTCACGAACGTGAGCGCACTTGGTGGAGTTTATGATCTTGATCTCAGCGGAT
GCATCAACGTCCGTGACGTCTCGGCTCTCGGCAGTGTCCACACGCTCGATTTATCACTATGCAAGGAAATCACGGACGTTTCAGCGTTAACTAATGTGAC
GATTTTATCGCTTCGTCAGTGTGATGGAGTCAACGATATCTCAATGCTCGGGCGTTCCCAGGGAAAGAGTACGCTACAAGAGCTTGACGTGTCGAGCTGC
AACAAAATCACCGATGTGAGCCATTTAGGCAACTTGAAGAGATTAGTTCTCAGTCGCTGTCAAAGTATTACAGATTTGCACGGGGTCAAGAACGTGCATG
AGCTGGACATCAGCTTCTGTAAAAACATTCGTGATCTCGGCACCTTGAGTGGGATTACCGTACTCAACGCGTACCGCTGTGTGGGTCTACGTGGGATTTC
ATCGTTGACCTCAGTCGAGAGAATCAACCTGTCTGGTTGCGCTCTGATTACAGACATTGCATCGCTCGCTGGCGCTCGGGAAGTGGATCTCCGTTTCTGC
GACGGCATTGAAGACGTAAGCGCATTGGGCCGCGTGCGTATCCTGAAGCTCGCTGGATGCCCTCACTTGAAGGATGTCTCTGGCCTCACGAACGTGTACA
TGCTTGACTTGAGCTACTGCCACCAAGTCGAAGACGTATCGGCTCTCGGCAATATCCACACGCTTTCGCTGAAGCACTGCAAACAAGTTCGTGACGTATC
CACGCTAGGACAAGTCCACTCGCTCAATTTGTCCGGTTGTGAGAGCATCGAAGACGTCTCTGCGCTCTCAAGGGTGCATGTCCTCAACCTCAGCGACTGC
AAGCGTCTTTGTGACGTGTCCATGCTCAAAGGTGTTCGCATTCTTGACCTGCGCTTCAACACTCGGTGCTCTGACAAAACGGGCACAGTCGAGAAGCACC
AACTGCAGGGAGTCGATGAGCTGCAACAGTTCGTGCCGATCATCAAATTGTAA