Transcript Name :
Pytul_DAOMBR144PYU1_G000534
Orientation:
(-)
Number of Exons:
2
Description :
Similar to yqjV: Uncharacterized MFS-type transporter yqjV (Bacillus subtilis)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-20
76-81
129-148
199-315
371-440
493-499
44-52
102-105
172-180
339-347
464-472
21-43
53-75
82-101
106-128
149-171
181-198
316-338
348-370
441-463
473-492
NN-scoreoddsWeighted Score
0.5231.2640.003
*** None ***
TypeScore
endoplasmic reticulum667
GO
*** None ***
*** None ***
*** None ***
Sequence
        1625 bases(100 bases per row)
ATGGGGATCGCCACGGACGCTGCACGCGCGCGCGGCGCCGCGCACAACGTCAGGAACACGTACATCTTCACACTCTTCTACTGGGCCGCCAGAAGGTACC
TACCTACCTGCACGCGATGGCTCTACGTCCATGTATCCCCACTACGAAGGTGCAGCAGAACGAGGTCTAACCGGTGCATTATTTTTCTTTTTTTGTCATG
GTTGTGTGCGCAATGTGCAGTATTTTGTTTCAGCAGGTGATCTCCGGGTACATTTATGTGCTTACTGACTCGAACCAGCCGGTGGGCATGGTCAAGGGCA
TCCAGGGCATCTCGCAGTTGGCGTTCTCGCTGCCCGCAGGCTATTTGGCGGATCATACGCGGCGCGACACGGTGTTGAAGATCTCGGGCGTCATTGGGCT
TCTCGGCGCGCTGCTGACGTTCATTGGCGTCGAAGCGAGCAGTCTGACGGTCATCTACGTGGCATTTGGGCTCTGGGGCCTCTTTTCCGCGTTCCAGAGC
CCCGCAATGGAAGCGCTGTTCGCAGACTCGATCCCGCACGGATGCCGCTCATATCCGTTCATGATCAAGTACAACGTGAGCAACGTGGCGCAGGTGATCG
GTCCGTTCTTGAGCATCCTGCTCTTCTTGTACTTTGGCGACGTGTGGCGCTTACAGGAGCTCCGTCCCGTGTTAATCTTTGGCACGACACTCGCTGCGAT
CGCGTCGGTGTTTTTGTTCCGCTACAATGACGACCTTGCTCTGGAAGATGAGCACGCGCATGCGGACGCGGCCATACTGCACCACTTGGAGACGCAGCAG
AGAGCGCGGCTCGAGTCGGAGCCGCTACGCACGCCGTCGTTCGCAGGCAACGACATCGAGATTGAGTACAACTACTCGGACGTGGAGGACGAGCTGATGT
GCGACGACGAATCGACGCGCGCAGCGGAAGAGTGCGGCAACATCATGGCGACCGAGAAGAGCTCGCTGATCATCTCGACGGGAAGTGCTACGGCCAACAA
CACTACTGGGAAACCGCAGACACAGAACGAGGCCCCGGCTGCACGCTTCCTGTGCCTCACGTCGGATCACGTGCCGCTGCTCCTGTTTCTCTCGGACTTC
ATCATCAGCAACGGCGCGGGTATGACGATCAACTTCTTCCCACTCTTCTTCATGAAGGAGTACGGGCTGTCGCCGATCCACGTGAGCATCCTCTTCCTCG
TGCAGCCGATCGTGGTGATGATCCTGTCGTACGCGGGTCAGCGCTTCTCTCGCGCGCTCGGCCGCATGCCGATCATCGTGTCCACGCGCATCGCGTCGAC
CGTATGCCTGCTCTGCATGACGTTCGCCAAGCCGCTGCACCTCCAGGTTGCGCTGTTTCTCATGCGCGGTGGCATGATGCGCTGCTCGCAGCCTCTGCGG
CGCTCTGTGCTCATGGACTTTGTGCGGCGCGAGGTGCGCGCGCGCTGGAACGCGCTCGAGGGCATCTCGGTCTTCTCGTACTCGGGCAGCGCCGTCATCG
GCGGGTATCTCGTCGACGCGTACGACTACCGCATGTGCTTCTTCATCACGAGTTTCGTCTACTTTGCTGGCCTGAGTCTCGAGCTCTTCCTGCTGCCGCT
CACGCGCCACGCGATCGAAAAGTAA