Transcript Name :
Pytul_DAOMBR144PYU1_G000544
Orientation:
(+)
Number of Exons:
1
Description :
Similar to SRF7: Protein STRUBBELIG-RECEPTOR FAMILY 7 (Arabidopsis thaliana)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-347
NN-scoreoddsWeighted Score
0.6912.1110.004
*** None ***
TypeScore
nuclear391
GO
*** None ***
*** None ***
*** None ***
Sequence
        1044 bases(100 bases per row)
GAAGTGGCAAAAAACAGTGGCAGGACCCACTGCCAACGATCAACTTCAAACTGAAAGATGCCGATGCTGGATTGGAGCTTCTGAACCCTGCAAAGTCAAC
CTCGACCAACCCTTTGACTGTCCCAGTTACCCCAAAATGGTTCATTCCACAGGAGTACATTGAACTGATCTCAGAAAACCACGGCGAGTGGCTGGGTGCG
AATGTGATGCTGTCCACATTTCAAGCGCCCTTTGCGGATTTTGAAAGCAGCGCTACTCGATGGCTCCATTGTCGACACCCACACGTAACGAAGCTGTTTG
TTGCCTGCCACCTCAGTAGCCCCCGCTTGCTAGTTACCGAGTACTTGCCGAATGGGACACTGCACGAGTTTTTGCAAACCGGTAAGAGCCAGAAGTCTAT
ATGGCATAAACTTCACGAAGCAGCGCTTGGACTTCAATATCTCCACCGCCACAAACTCGCTCATGGAGACCTTCGAAGCGAGAATATCGTGATGAACAGC
AACTCCGAGGCTCAGATCACCAGAGTGGGACGCACTTCAACCTGCATGGGCCCAGGATGCCAAGAGTACAAGGCATCAGAACTTCTATGCCTTGAAGAAC
CATCGCTGGCATCTGGCGTCTGTGCATTCGGAGTTTGCACCCTGCAGTTCGTTGTCGACTATTTGCCAGATGGAGATCGGGGATATGGGAAGCGAGAGTG
GCTAACATCGAAGCCACACGGAATGGATGACGTACATTGGTGCCTCATCACCGATATGTGCAAACAAGACCCAAAGGACCGAGTGAAGATCACGTACGTC
GCCATGCAGTTGAAACGATTTTCGAACGATGAAGCCCAAGAACATCACGAACAACACGAGATGGAAGGCGTTGATGTTGCAACATACTTGACCCCGGAGA
TTGCACAAACCGTTGATAAAGCTGTCGATATCTTGCAAAAGAGATACGCCAAGTGGTCTATAATGCAGCGAATGCCTGGTGATGAACTGGCGCGCGTGTC
TGATCTGCACTCTCAACTTGAACAGAAAGGTGACAAGTGTCCAG