Transcript Name :
Hyaar_Emoy2814235
Orientation:
(-)
Number of Exons:
2
Description :
reverse transcriptase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-171
NN-scoreoddsWeighted Score
0.8724.8320.01
*** None ***
TypeScore
mitochondrial696
GO
*** None ***
*** None ***
*** None ***
Sequence
        1041 bases(100 bases per row)
ATGCAACGCCAATATCAACGTGCTCGGGCGGTAGTGAATGAACGACTGAAGGTTGCGATCAGAGGTCGAGCCGATCGACATAATGAAGATCGATATTTAT
TGGATACCGATCGCGGGTCGCGAGTTTGGCTATATCTAGACCGAGTCAAGGAAGGATATGCTCGAAAGCTAGCCCATATGTGGCATGGGCCTTTTCGAGT
GGCCGAGAAGTGTGGCGATCACGCCGTAAAGTTGGACATCGCCGGCACGCCGTACCGGCTATTCCCAATATTCCACGTGTCTAAGCTGAAGCTAGTTCGC
ATATTCCCAGAACGCCCAACGGGTGGATTAAATGCGGATGAGGCAATTCGGTTTGATTTTGATAAAGCACTGCTGCCGGAAGATAGTTGGGAGGGTAATC
TCGACGCGGAAGAGTTGAAGTAGACAAGATCATCGATGTGCGATCAGGACGGAAGACGAGATATGGCCGAATACACAAGCAGTACCTGGTACAATGGAAG
GAGTACAGTGACCCAATTGACGAAGCTGATCTAAATTTTCGAGCTATGCTGTAAGAGTTCGATTGCGATCAGGTGAGCAAGAATCGTTTTGATGTGATGC
AATCGCACGAGGAAGAGCCAGAGAATAGCGATGATCGGAGAGTTTGAGTGGACGGGTCTATGCAAGGACGGTGCATGGACGGGGAGAAGAGTTATGGGTG
CAAGGAAGTTGCACATGGAGATGGAATGGGATTTATGTGAATTGAGTGCGACGATCGCAGACTTAATGCTGCGATCAAGATGAAAAGACAAAAAAAGATG
AAAGAAATACGAATGATGGGAGCGACCAAATGGAAATGAGAAGAAAGTAGATTGAGAGATCGCATCATGGAACAGACCAAGTAAATCACTCGCGGTCAAA
GAACTTACCACCCAAGCTTGGAAGAGACGATCCAGGGTCGGATGCGATCGAACGACGAAACTGGTTCCTCCAACGCTCGGAAGCGTGATTGATCGACAAA
GCAGTGATCAAGTTGGGTATGTTGGTCCACCGCACGGATAG