Transcript Name :
Hyaar_Emoy2813953
Orientation:
(+)
Number of Exons:
1
Description :
Amino Acid/Auxin Permease (AAAP) Family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-45
96-101
164-174
250-333
382-393
69-77
125-143
198-226
353-361
414-449
46-68
78-95
102-124
144-163
175-197
227-249
334-352
362-381
394-413
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
5
Sequence
        1350 bases(100 bases per row)
ATGGTCTTCATGGCTTTTGCCAACGTGTACGGGGCAGTGGCGATCTGTCGTGTGATGCTGATGGCTCCTCGCTCAGTCAAGACGTACGGCGATCTTGGCG
AATGGTGTATGGGTACACCCGGTCGCTACTTGTCCGTCATCTCGCAGATGGCCAATTGTCTTCTAGTGCCGTGCGTGTTCCTCGTATTGGGTGGAACACT
CTTGGATGGACTTTTCCCGAATGCCTTTAGTGCGACCACGTGGATCATTCTCATGGCTCTCTCGTGTGCTCCTATGTGTCTCGTCCCAACGCTGAAGGAA
GGAGCAGCAGCCGCTTTCGCCGGTTGTATGGGCACCATCATTGCTGACGTGATCGGCGTCGGCATCGTGCTGCACAGCATGCGAGGCCACCCGAGCATCC
CCAAGCCCGACCTCAACTTCAAGCAAGTGGCTGGTACTTTCGGCAACTTGGCTCTGGCCTATGGCGCTGGGATCGTCATTCCGTCGCTCCAGCGTCAGCA
TAGCGACCCCACGCGCATGCCTTGGGTCGTCGGGATCACAATGTTGTTCATCTCGGTCCTCTTTCTCATCCTGGCCACCTCGGCGTATTCAGCTGTTGGA
TGCCAGATCTCGGGCAACCTCCTGTACGCGATCTACCCTGACGAGACGGGCTTGACGACGCTCGGCTTTGCGTCAGACTGGGGCATGGTCGTCCTTGCCT
ACCTATTCATGCAGCTGCACATTACGATCGCTTTTTCTGTGATCCTTAACCCAGCCTTTTACATTGCCGAGCGCATTGTACTCGGCATGCATAAAGCTGT
CGCCTCGGATGTCGAAAACAATTTGCTCAGCTACGTTGAAGTGTCGACACCTGACGTTGGCGAGCGCTCCGAGAAACATTCACCCACGTCCTGCGTCTCA
AAACGCCGCTCGATCCTTTCGGTGGCCGACAATGAAAATACTCAGTTCGATGACCCGGCGGCTGAGACTTCCGAGTACAGTGGAGCAAATGTCGTGAAAT
ACATTGCACTGCGCCTTGCAATAATCACGAGCCTTGTGGTCGCGTCAGTGCTCCTAAAGGACCACTTCCACGACTTGGCAGATTTCACTGGAGCGTCTTG
CATCACAGTCAACTCTATCGTCCTGCCCATCGTTTTTTTGCTGAAGAAGAGATGGAACATTTTACCAATGTGGGAGAAGATCCCAGCGCTAGTCGTGGTC
ATAGCATGTTTCAGCCTGGGATGCTACGTGACATATATATCAGGCAAAAACCTGTTTGTTCCCAGCCACGACGACACAGCCTTCCCATTCTGTGCGCCAG
AGTTTAAAAATACTGTGTACTACAACTACACAGCTGCACACGAGGGCTAG