Transcript Name :
Hyaar_Emoy2812186
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain10.364PS50294
WD40 repeat9.573PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat26SM00320
WD40 repeat0.37SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-259
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        780 bases(100 bases per row)
ATGACGTGCGAGAGAAGGAGGACAAACAATGTCGCTGCATCATGTGCTGCCTCTTTACAAATTGGAGTCAACAAATCGAGCGTCACCACACTCGTGTTGT
GGTGCCCGAGAGCTGCTTTTATCTGCAGCTCCATCCAAAAAGCATTGAGACAGATAGTACACATGGGGTCCAATACTTCTCGTGACGAGAATGGGTCATC
GCGACGTCTTTGGAACTGGACCGTCGAGGACGAGACGCCACGTCTCATTGATGGAACCGCTTTCACTCCGAGTGGTGCAGCAGCTTCAGGTGTAGTAGGT
ATAGCCGACCAAGCGCGTAATCTTCTGGCTCTGAACTGCATCAAGTACAGCTCGTTCTTGGGTGATACCTGCCTTACCGGCTGTACCGATGGCTTGATCC
AGCGTCTCAATTGGCGGCTAAAAGCACGAGCCCCAGACAACGGCTTGAACGTGTGGATCCCTCACTCGGAGGCTGTGACTCAAGTGGTTATTGGAGCCAA
GCTGCAGATGATCTACTCGTGTTCACTTGACACGACGGTAGCCATTACGCCAATCACGGATAAACCGGCTTCAGAGACGGCGACAGTACTACGAGGTCAT
CGACTCTGTTTCGCTTCTGTGGCAGTTGATGACGCCGAGCAAATGCTGTGCTCAGGAGGACGAGACACACAGACGATCTTCTGGGACCTCACGACGAGTT
ATATTGCAGCCAAGACCACGACGCCCGAGAAAGTCGTCACGTGCTCGACGTGGTCGCCAGGTGAAGCGCTCGGTGCGTAA