Transcript Name :
Hyaar_Emoy2810989
Orientation:
(+)
Number of Exons:
3
Description :
conserved unknown protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
79-134
343-374
1-55
158-319
56-78
135-157
320-342
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
4557
Sequence
        1337 bases(100 bases per row)
ATGTTCCGTCTGTCGGACTTTTTCTACAAAGAGATCTTTGGCGTTCATGATATTAAACAAAGTGATGGCGTGCATCAAGAACGCGTGCAAAACTTTTTTG
TTGTGCCGTTAAATACTGAGCAGCTGTTTCTCTTTGGTGTGCTGCTGGCACTGGATAGTTTTCTCTACGTCTTTACGTACATGCCACTCCGGATTTTATT
TGCCTGTGGCTGTGCCGTGACTTCAAGTTTTTACGCACGGATATTTCGACGCACGCACTCTGCGACNNNNNNNNNNCTGTGGTGGATTCTTTTACGACTT
GATGGTGGCAGTGATTATGGCTGTAGGGACAACTGTGCTAGGGTACGTGGACATGTCGAGGGTGTACCACGCCATTCGCGGCCAGGCGATGATTAAACTC
TACGTGCTGTTTACAATGATCGAGATCTTTGATCGCTTGTTCTCGTCCTTTGGACAGGATGTGCTGGACTCACTGTACTATACAGCCAAGTACCACCCCC
GTCGGGTTACGCGCATGTTTTTGGACTTTAGCGTGGCAATTGTCTACGTGGTGCTCCACTCGTTACTGTTGTTTGCCCAAGTTGTGACAATGAATGTTGC
AGTCAATTCAAGCAACACGTCACTGCTCACGCTCCTCATTTCCAACAACTTCGCCGAACTCAAGAGCTCGGTTTTCAAAAAGTTTGAAGAACAAAATTTG
TTCCAGATCAGCTGCAGCGATATCGTCGAGCGCTTCAAGCTGCTCACTATTATCGGACTCATTCTGCTTCAGTCGTCGACTGGCGATGTCGCCTGGGGAA
CGGTAAGATGCTTTTGGTTACTTACATTTTTTCATTGGTGTGAGCATTGTTCTCAGCTAGTACGCACTGCTTCTGATGTTGTTATTTGTTTGCTCGTAGG
CCATGGTCTGGGTGGCTGAGATGCTGATTGATTGGATCAAGCATGCCTTTATCACCAAGTTTAATCAGATACCGCCCACGATGTACTCCAAGTTCATCAC
AATTCTTTGTCGGGATCTCACAGGCTGGAAGAGCGAGAACACAATTCTCGATCATACGCACCATGTGTCCAAGCGTTTGGGTCTAATGTCGCTGCCTTTA
GCGTGTGTGGTGCTGCGCATGTTGTCGAAGGCTCTTGCCGACGCTCCGATTGAGCTGACGTCGCCTAGTGGCATCTTGATCACGGTGGTGTTTTTCATGT
GTCTCGCAGCGTTCAAAGCGCTGCTGAGTCTTGTGCTGATGATTTACGCTTACAAATCAGGTCGCCTGGACGACACACGTCCGAAAAGTCCACGGTCCGC
GCGCCATCTCGAGTCCATACATCGATACAAGTTTTGA