Transcript Name :
Hyaar_Emoy2808847
Orientation:
(+)
Number of Exons:
2
Description :
conserved unknown protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain1.2SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-339
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleotide bindingGO:0000166IEA
*** None ***
Cluster Id
3849
Sequence
        1110 bases(100 bases per row)
ATGTTTAGCACCACGTCGACGTCTAAGGCTAACGCTCCCGCACCCGTGCTGCCCTGGGTGGAGAAATAGTAAGTGCTTCGAACATATTCTCTCCCCCTAT
ATCTCGTACATACTCACTCGACCATATGCTTACTAATGGCTTGGTTGCTCGCCTCCAGTCGCCCTAAGAATGTGGACGAGATCTCCCATCAGACACACGT
CGTGGCCACACTAAAGACATCTATCGCAAATGGGCAACTTCCCCATTTGCTTTTCTATGGACCTCCAGGCACTGGAAAGACGTCCACGATTGTAGCTGTG
GGGCGTCAACTCTTTGGCTCGGATTTTCGCAAGAATGGTCGCTTCTTAGAGCTGAACGCGTCAGATGACCGGGGCATTAAGGTGGTGCGGGAAAAGGTCA
AAAGCTTCGCTCAAGGAGCCATTAGTACCGCCAGCGGCCTCCCCCCTTTTAAGATCATTGTGCTAGACGAGGCCGACTCGATGACAGGGGACGCACAGTC
GGCATTGCGTCGCATGATGGAGAATTACTCTAAGGTCACGCGTTTCTGTCTAATTTGTAACTACGTGAGTCGTATCATCGAGCCCGTGGCCTCGCGATGT
GCCAAGTTTCGCTTTGCTCCACTAGAGAAGGTCTCGATGACGACTCGCGTGCGCTATATCGCGACAGAAGAACACGTGCGTGTGTCGGATTCAGTGCTCG
AGTTGCTGCTCGAGTGCTCGAACGGTGACTTGCGAAAGGCGATAAATTACCTCCAGAGTGCCAAACAGCTCTGCGGGGATGAAGAGTTGTCGGAAGGCGA
CGTCGTTGCGGTTGCTGGACTAGCTCCGCCTGAACTGCTGCAGCAGTTTTGGGCTTCTGTTGCTTCAAACAGCTTTGACAAGATGAAGACCGACATTACC
AGCATTTTGCTAGCAGGATACCCAGTGCTGACAATTTTGCGGCAGCTGAACGATGACGTACTCGCACTCGAAAAGATCAGTGATGCGCAAAAGGCGACGA
TCTGTCTGCGCATTGCTGAGGCCGACAAAAAGCTTGTCGATGGCGCTAGTGAGCATTTCCAGCTGCTAGACGTCGCATCCCACGCTATGCGCGTCTACAA
TACATCGTAA