Transcript Name :
Hyaar_Emoy2808848
Orientation:
(+)
Number of Exons:
1
Description :
replication factor C subunit 4
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-157
NN-scoreoddsWeighted Score
0.5121.2060.002
*** None ***
TypeScore
nuclear391
GO
*** None ***
*** None ***
*** None ***
Sequence
        474 bases(100 bases per row)
ATGACGACTCGCGTGCGCTATATCGCGACAGAAGAACACGTGCGTGTGTCGGATTCAGTGCTCGAGTTGCTGCTCGAGTGCTCGAACGGTGACTTGCGAA
AGGCGATAAATTACCTCCAGAGTGCCAAACAGCTCTGCGGGGATGAAGAGTTGTCGGAAGGCGACGTCGTTGCGGTTGCTGGACTAGCTCCGCCTGAACT
GCTGCAGCAGTTTTGGGCTTCTGTTGCTTCAAACAGCTTTGACAAGATGAAGACCGACATTACCAGCATTTTGCTAGCAGGATACCCAGTGCTGACAATT
TTGCGGCAGCTGAACGATGACGTACTCGCACTCGAAAAGATCAGTGATGCGCAAAAGGCGACGATCTGTCTGCGCATTGCTGAGGCCGACAAAAAGCTTG
TCGATGGCGCTAGTGAGCATTTCCAGCTGCTAGACGTCGCATCCCACGCTATGCGCGTCTACAATACATCGTAA