Transcript Name :
Hyaar_Emoy2808614
Orientation:
(+)
Number of Exons:
1
Description :
transglutaminase elicitor M81C
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7870.83827
InsideOutsideTMhelix
1-555
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1668 bases(100 bases per row)
ATGGTCTATGCGGTGCATCGCCACCTCCTCTTGGCAGCTGTAGCTCTTGCCGCTGTACAGTTAGAGCAGGCTATGGCCACGTCTCTCGATTACGACCCCG
TAACGTCAGCCAACACGACGAACGAGATCAGCAGCAAATTTCCAGGTCGGGGAGCTGAAGTGAGCGACGACGACTGCTCCATATCTGTCGAGGTGGACCC
GACACTACCTGATATCTCTACCATCCTCAAAGTTCCCGTGATGTACACGGACCTACTGGCCAACATGACGACGGCTCCAATGGAGTGTGTATCTTCAAAG
ATCGGCACGGCCGTCTTGTCTGAGGCCCTTCCGGCCACCGAAGCTGATCAAGATGCGTACACTACCACTATCTCGGGGTTCAATGTACCGTCCAAGACGG
GTATCACAACCGCAGCTTCAGCCACCCCAACACCAATCACCGACGTTGAGACTTCTGAAGACGAGCTGAACTGTGCCACCGGTTGGACTAACTCGAGCCG
CAAACTACAGGATACAAGCGAGACCAAGCGGCGCCTGGAAGCTACTACGAACGAGGACATTGCGAGACTTGAGGCCTATTTTGGCACGTCGATGGAAATG
AAGCTGGCCAATCTGCCGACTGTGGGTGTCTTAACACCGTCACCGTGGCCTGGTCCGTACTGGCCAATGTTTCAAGACAGCATCAATGTCATCTGGAGCC
CTGGCCAGCCAAGTGCTGCTGAGAAATACGCGAAAGCGTTTGGATTGAACGTCCGTGACTTTATGGACAAAGTCTCGGCCGACAACGGTGTCGACTCTAT
GCACCAGCGCCCCAAGTGTTCGTCGGACGACGGCTGTTCGTCTCGTTCCGATGGAAGTGTGTGCGGGAAACGTGCGGGAAAGAGCTCTGGGTACTGCATC
CCGACTTGGTTCGGGATCTGCCACGCCTGGGCACCAGCTGCTACAATTGAAGAGGAACCGCGGTGTGCTGTGACACACAACGGCGTGACGTTCCAGCCGC
TGGACATCAAAGCTTTGATCACGAACGTCTACGATGGCGCGTCGGTGCCCGTTGTCTTTACTGGTGCGAGGTACAATGGCGGTCACGACTCCGAGGACGC
GTACGGTCGTCACTCGAATGACGCCTACCGTGACCTCAATCCTGCCTTCTTCCACATTGCTGCTGCCAATATCTTGGGAAAACTTAACCGCACGTTCGTC
GCTGATGTAACGGCTGGGACGGAAGTGTGGAACCAGCCCGTGCGTGGTTTCAAAGTGTATGAGCAGACTAAGATATCGGTAAAAGAGGCTGCTCGGATGT
TTTACGGCCTTGAGAAGTACCCGTGGAACGCTGCGGCCAAGAGCATTGTGTACATTAAGATGCGTCTGTCCTGGATCTTCGAGACGTACGACGACGGTGG
TCTAGTGTCCTCTGGTCAGGTCAACAAGTACACTTCGGGTGCGTACTACACGTATCTGCTTGAGCTGAACAACAACGGGAAGATCATTGGTGGCGAGTGG
GTCTACGAATCAGACAGCACCCACCCGGACTTCCTTTGGCTCCCGAAGTCGAAGCCAGCTCTTGACACTGTGACTAGCGTGGGGCTGAAATACGCTGACG
TGAGCATGCTTCTGGAGAAATCGGTGGCTTGCTCCGGTTCTCGTTCGGGTTCTGGGTCTGGCGAATAG