Transcript Name :
Hyaar_Emoy2807018
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain14.973PS51192
Helicase, C-terminal11.838PS51194
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain1.4SM00487
Helicase, C-terminal4.2SM00490
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Helicase, superfamily 1/2, ATP-binding domainIPR014001
*** None ***
InsideOutsideTMhelix
1-1264
NN-scoreoddsWeighted Score
0.6422.1740.004
*** None ***
TypeScore
nuclear870
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
*** None ***
*** None ***
Sequence
        3795 bases(100 bases per row)
ATGCCGCGATGGCGGTGCGAGTACGAGCGCGACTGGCGCGACTACACGAGGCAAGTGATCGCCCATCGCTTTGGCACGTACGCACTCCAGTGCTCTCCAT
CTGTCAATCCGGCTGACGAGCAGCTACTGCAAGACGTTTTGATGACAGCAGGCATCGCCCACGTTTCTCTGAGTCCCAGTGTGTGGGCTGCGCCTGTCCC
AGCATTATCGCCATCGCTTTCGATACCTAACGCGTCTCTTCTATCCGAAGAGTCGTATGTCTTTAACACTCCGCCTCCTTTAGATGACCGAAGCGAGTTC
CCAGGTTTCGGCCCGGAGGAGTTTAGGTCCCACTCGACGTCAGGACGGCGAGTTAGCGCCTCGCAGCGATTACAACTGCGAATGGCTGACGTGTCGCCAA
TTGTTGGAAGTCTGAGATCTTCTATTGAACGTGCAAGGACCATCTCTCCACTTTCAGCAGCAGCAGCTACGTCGCCCTGGACGTCGGGACAGTGGACTGG
AAAGACACGGCAAACACGTCGGATTTCACTTGAGTCAAACTTTAGGGACAAAGAGCTGGATGTTTCGATGCATTCGTTGCACTTGAGTGAGGATGAAGAG
AGTTTTTGTATAATGGATGAAGGAGAGGTAGAAGGTACGCAAGTGACCGAGATATTGGAAGATTATGAGAAAGAGGGAAAGGATGTGGCGGTGCAGGGAC
TTATACGCAGAGAAGAGGTTCAAAAAGTGCAACATATTGGGAATGTGAAAATAGACGCTGATGAACAAAATGCTCGAGTGCGTGCAGCGAAGCAGCATGG
TAAAGCAGAAGGTACAAATGCCTCTCGACGGCTGGGTTTCCGCAGTTATAAAGAAGATGAAGATATGAAGCACGATGATGTAGAAGAAACGAACAAGCAA
GTTGATGCCAACGCTGTGATTGATGACCGAGGCGGGAATGCAGACACGCCGCTCGATGTTGAGAGTAAAGTCAATTCAGTCAATTCTTCTGACGGTAGTG
ATGTATATACAAAGGAGCCAGACAGGCATTCAGAAGCTGACTTTGAGTTTGGAACGGGAAGTGAGTACGATAGCGAGAACCAGCCATTTACGCATGAGGA
ACAAGATGAGGAGACACATCATCGATCGCAACGTGCAGTGGAAAGTCTACTTTATACCATTGATGCTGTTCAGGATATTACAGAACCAGAACCAGAAGAT
GTCTATGATCGTACTAGGCAGCAAGACACTGATGGGATGTCAAGCTCAGTCCATATTCCCACTTCAACGAAGTGCATTCGTGCAGTACAGCAAAATGAAC
CTGTGCTGACAAGTCAGTCAACTTGCGCTTCATCGGCAGAGTCCATGGTGAAAAAAGCAGTGTATTCACCTACTACTGCGCAAGCGACAAGAAAAGCGTC
TTGTACGACATTGATAGCTTTGTCGGCTAATCGAAGCTTGACGTCGCCTGCGAATATAACAACGCCTGCTACGTCAACAGCTCTGCCAGCAAGGGAAGCC
TTGCATGCATCTGTTGTTCGTTCATCGACAAGTGAAGCAGCGCAGCATTTCCCGACCACCGCTCCAGCACTTCGTGGGTCGGCGTCATCACGAAAACGTG
CAATCCGAGGTGCGCTGTTGCACACGAAGCTGCCGCTTCAGATGGAGTACCGATTTGCTAGCGACCGGCGTCGGCGTCATAAACGCCGAAAATCGTTAGC
GGCCAAGCCGGGCGTGTTTCCATACGTTGTGCCAGAACTTGTGATTGAACTGAAGTCATATCAAAAGGAGGCACTACGATGGATGCTGGAAAGAGAGCGG
GAACCTGGTGATACCATCACTATTGATCGTCAACGGTGCGGTGGCACAACGGCTGTCGACGCGTTTATAGCGAAGGTGCGCGGTGGGATATTGGCAGATG
AAATGGGCCTTGGTAAAACGGTATGCTGCCTTGCTCTAATATGTGAATCGTTGCGTCAGGCTCGAGCGGCTGACGCTCAAGCAAGTAATGAGACTGGTAG
TGATGTCCTCCGGATTATTCCTCCGACGCTTATCATAACGCCGCTGTCTATTCTAACGCAGTGGGAACAAGAGATTCGAGCAAAAACGAATTTGAGTGTA
GTGATTTACCAAGGTGCTGCGCGCAAGAGCTTCCACTCATCCACGCAGTTCATGGGAGCAGACATTGTCCTCTCAACGTACGACACCCTTCGGCTTTCGG
AGTGCAAAGTACGAAGTAAAGGCAGTGGCAATGATGGTGACGGACACAATGGCTGGGGTGCAGAAGATGGATGGCACCAAGCGCCACGCCTTGTTCCTCG
ACGTCAGAAATCTGTAGCGACATCGAGGCTGCACCAAGTGCAATGGTTTCGAGTCATTCTGGATGAAAGCCATCTCATTGCAAATGCTGGATGTGGACGA
GCGCGAGCTGCGTTTACACTCAGCAGTAGACGCCGTTGGTGTGTGACCGGAACACCAATTCAAAATCGAACAGCGGATCTAGCAGCGCTGCTGCAATTTG
TTGGACTTGGTGATCGGGCCCATGCTTTATCTGAACGGGAACTTGGATTGCTTGTACCCCGTATCGTTTTGCGTCGACTAAAGTCCACGGTGGAAACGCG
TTCAGGGGCTCCTATCTTGGAGCTACCAGAAAAGTCCGAAACGACTATCGAGCTCGACTTTGCCTCAGATATTGAGCGTGTATTGTATTTACTGTTGTAT
CGCTCCACAAAACGGCAAGTGTTGCGGTATTTGCAGTCGAAGGAGGCAAAACGAAAAGCTCGTCAAGCTTCTTGTACAAGCCTAACCGAGATCGACACGG
ACCGACCTCTGTTTATGCACGTGTTCGAACTTATCCTACGGCTAAGGCAAGTGTGCAATTCTTGTGCTCTGGTGACCGCAGACCCATTAGCGGACGTTCG
AATGCGAGTAGAAAAGCTAGCTGGGAACGAAGGACTCGATGGCATGTCTTCATTCTCAGATGCTGAGGCTGAATTGCTGAAGCGATTCCGGAAGCAGCGC
TCGGGTGCGGATAGTGATTTCGGACACGGTTCATTGGAGTCTACAAAACTGACAGCACTGATGAAGGAGCTGAAGAGCGTACGAGCTTGTCGAGAGCGAG
TTTTGGTGATTTCGCAGTGGACAAGTTTTCTGGATATGATAGGAGCACACCTGGAAGTTCACAATGCGCAGTGCGAGGCAAGAGTTTCATCCTTGAACGA
TGCGCGAGAAACAGGCAATGAGGCTATCGCGTTTGCTAAATTAGACGGTAGGATGTCCGCCAAGGAGAGAGAGCAAGTGGTGCACAATTTCCAGCAAAAG
GAAGTTAGTTTCGACAGGGGATCAGTTGTTGGTCCACTGCTTGACGTGCTTCTGCTATCATTGCGTACTGGTGGCCTCGGATTGAATCTCACAGCTGCAG
CGCATGTTTTCATCATAGAACCTAGCTGGAACCCGAGCCTTGAACACCAAGCAATCGATCGCGCTCACCGTTTCGGCCAGACAAAGCAGGTGCGCGTTGT
CCGCTTTATTGTCAAAAGCTCTATTGAGGAGCGTGTCATGGCTTTGCAAACCAAGAAGCGCCAGCTGACGGCTACTTTCTTGGGGGATAGCGATATCGTC
TCCAGTACCAACAAGAACAACAGGCTTCGCGAGACAAGGCTGTCAACTCGAGATATTCGAACGCTTTTCTTTACGCAGCAGGAGCAAGTTGAAGAAGTAG
ACCCGCGCCGTCTTGATGGCAGAACTGGTCATGCACGCAATGACGATGCTGAAAGCAGCGACGGAGGTGTGACGTGCATTGAAATCAGTGACTGA