Transcript Name :
Hyaar_Emoy2806663
Orientation:
(-)
Number of Exons:
7
Description :
PREDICTED: dihydropteridine reductase-like
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-122
146-253
123-145
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1317 bases(100 bases per row)
ATGTCGACTATAAGGTATCAGTCAGTTCGTCTACGGAATATTACAGTAAAGTTCAAAATACCCAATCGATTGTCATCATTTGCTCTTGTTGTATGTAGTT
ATGTCACGAACCAATTGGATGTCACTATCGAGGGGAAAGGTCTCTCGATAGTGACTGTCCGATTTGCTGCATCATGTCCAGCAAGGTACTCGTTATTGGA
GGTGCTGGCGCCCTTGGTCGTGGCATCGTTCACCGCTTTGCACGTGTATCGTGGGGTGTCACTTCAGTAGGCTTTGATGCGAACGAAGAGGCGGAACATA
ACGTGCTTCTGCCAAAGAGTAACGTGCTCAAGGAAGCAAAGCAGACGCTGCAGGAGATCTCCAGCAGGTATTGTATTGTATTGCATTGCATTGTATTGTG
TCATTGTATTGTGTAATTGTATTGTGTTATTGTATTGTTATGGTCAGCTAGTTATAAAGGAACAATATATATTGCTTGAGATTATGCTGACTCGGTGTGG
TACACAGATATGGCAACGTGAACTCTGTCGTGTGTACGGCAGGAGGATGGGCAGGAGGCAGCATCCGTGATGCAAGTTCGCTGGCCAATCTATCGGACAT
GACCGCCAAGAATCTCGAGTCGGCTTTCTTAGGTGAGACACAATGTGCTTGCCGAGAGAGATCTCAATGCTTATCTCGGTTCTGGTTGTAACGGCTCAAT
GACGATCGGTTCTGTCGTTCCTTTATTCTCCTTCTTTCATAGCGACGTACTTGGCAAGTCACTTGCTCGTGCCTGGAGGCTTACTCGTTCTGACTGGGGC
CACTGCAGCACTCAAGGCGACACCTGGCATGGTGTCTTATGGAGCGAGCAAAGTGGCAACGCACCATTTGGTTGCTAGTGCCGTGTGAGTCTGTTGGACG
TTTCAGGTTCAATGAGTACACACGTTCGTTCACACTTGTGTACTGATCGTGCTGTTGTTGTATAACGTGTGATGCTTGTGACAGGACGGAGCTGCCTGAG
AGTGCATCAGTGCTGGGCGTCCTGCCGACGACGATCGATACGCCGATGAACCGTCAGTTCATGGCCGACGCTGACTATTCCAGCTGGACGAAGGTACGGG
CTTAGGATGAAACAATATAGAATGTCTGATCGCTCACATGACCGTGGCCCTTACGTGCACATGGGGATGGAAACACCAGGTGGAGGATATCGCGCAAAAG
ATATACGAATGGTCGATTGCTTCCCATGCTGCCCGTCCTCCGAGCGGACACTTGGTCACTTGTGTCACGGAGAACAATACGACGGATTGGACGGACGTAG
GCAACCCGTTTTTGTAG