Transcript Name :
Hyaar_Emoy2805204
Orientation:
(-)
Number of Exons:
1
Description :
DNA replication licensing factor MCM5 putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
DNA replication licensing factor Mcm4.6PR01661
DNA replication licensing factor Mcm4.6PR01661
DNA replication licensing factor Mcm4.6PR01661
Mini-chromosome maintenance, DNA-dependent ATPase1.2PR01657
Mini-chromosome maintenance, DNA-dependent ATPase1.2PR01657
Mini-chromosome maintenance, DNA-dependent ATPase1.2PR01657
Mini-chromosome maintenance, DNA-dependent ATPase1.2PR01657
Mini-chromosome maintenance, DNA-dependent ATPase1.2PR01657
DNA replication licensing factor Mcm4.6PR01661
DNA replication licensing factor Mcm4.6PR01661
Profile scan predictionP-Valprediction_id
Mini-chromosome maintenance, DNA-dependent ATPase87.351PS50051
HmmSmart predictionP-Valprediction_id
Mini-chromosome maintenance, DNA-dependent ATPase1.8SM00350
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-750
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
DNA bindingGO:0003677IEA
nucleusGO:0005634IEA
DNA helicase activityGO:0003678IEA
DNA replicationGO:0006260IEA
DNA replication initiationGO:0006270IEA
*** None ***
Cluster Id
2216
Sequence
        2253 bases(100 bases per row)
ATGGACTGGGATGCGGGTCGCATCTCTTCGGTGGGTATGGAAACCGCCCAGGCCTCCGACGCTCGACAGACATCAAGCCCGACAGCTCTGCAGCATCGCT
TGCTGTCTTTTCTGCGTGGTTTCCGTGTTGGTCCTTTGTTCTACTACCGTGAGCAGCTATTGGCCAACGCGCGTCGCCACCACTGGTTTGTGACGGTGCA
TTTGTCTCACGTCGCAGCTTTCGACCAAGAGCTACAAGATCTGTTGCTCAAGAGCCCCAAAGAGCAACTGCCTCTTCTAGAAAGTGCAGCAAAGGAAATG
CTGGCGCAACTGCTCGTTTCCTCCCAAGAGTCGTCGGTTGCCGCAATCGGTGATTCGTCATCATCCGATACAACTTCAACAGTAAAGGGTAACTTGCCTG
ACATCCAAGCTATTCTTAGCAGTGACCAAGCCCTAGTACCTCTCCGGCATGTGCATGCCCAGGAAATCAATCGTCTGGTGAAAGTTCCTGGTATCGTAAT
CAGCGCGACACGAGTGCGCACTAAGTGCGTTTCCGCAACAATTAGATGTCGCAACTGCGGCCACACGAAGCGGGTCGCTGCTTCAGGAATGGGTGGCGTG
AGTATCCCTCGCTCGTGTGACCGTAATCGAGACGACGAGAATGCGGCAACGCCCGGTGAAAGGTGTCCCAATGATTCGTATTCAGTCTTGCCGGACAAAG
GTGATTACGTCGACCAGCAGACGCTGAAGTTGCAGGAGAATCCCGAAGTCGTTCCAACCGGTGAAATGCCGCGCAACTTGGCGCTGATTACTGATCGTCA
TTTGGTTGACAGAGCATCACCTGGCACGCGCGTGTCGGTTGTAGGCATCACATCCGTCATCAATGCGGGAAGCAAAAACGTCGGCGCTGTTGCCATTCGC
ACGCTCTATTTGCGTGTCGTGGGTCTTGAAATTGACGAAGAAGGGGCTGGACGAGCCAAAGCAACGTTTTCCCCCGCAGAAGAAGAGAAATTCCACGAAA
TGGCGCGAGATCCATATGTTTATGAGAAACTCGCCGCCAGTATTGCGCCATCAATTTATGGCGACTATACCGTAAACATGAAAAAAGCAATCGCGTGTTT
ACTCGTCGGTGGGTCGAGGAAACGATTACCAGATGGTATGATCTTACGTGGGGACATCAACGTGCTCTTATTGGGCGACCCGAGTACCGCAAAATCACAA
TTTCTGAAATTTACCGAAAAAATCGCTCCTGTTGGAGTCTACACATCCGGTAAAGGCAGTAGCGCCGCCGGGTTAACAGCGTCGGTGATCCGAGATGCCA
AAGGCGAGTTCTACCTCGAAGGAGGTGCAATGGTCCTCGCTGATGGCGGTGTCGTGTGTATTGACGAGTTTGATAAAATGAGAGAATCCGATCGGGTCGC
GATCCACGAAGCGATGGAACAACAGACGATTTCTATTGCCAAAGCAGGGATTACCACAATCTTGAACTCGCGAGCCAGCGTCTTGGCAGCTGCCAACCCC
GTGTTTGGTCGGTACGACGATATGCGCTCCGCATCTGAAAATATCGACCTCATGAGCACGATTTTGAGTCGGTTCGACATGATTTTCATTGTGCGGGACA
TTCAGGACGATACGAGGGACCGCCAGATGGCGGCGCACGTTGTTCGAATGCACTCGAACGCTCTGGCGTCCGCCGCTGGCGTCTCGTCGGCCAATGAGAA
GGCAACAACGACTGGTTCGAAAAATGAGATTGATCCGTGGTTACTTAAGAAATACTTCACATACTGTCGGACGCGGTGTGCGCCCCGTCTGTCGGTTGGA
GCCGCACAGACGCTGCAGGACTTTTATGTGGGTGTTCGGGACGACGTCCGACGAACACAGGGCGGGGAAACGACGATCCCAGTGACGGTCCGTCAACTTG
AAGCTCTTGTCCGGATCTCCGAGTCGCTGGCAAAGATGCAGTTGCTGAATGAAGCTACGCGGGAGCACGTGCAGGAGGCGATTCGTCTGTTTAGTGTGAG
TACAATGAACGCTGCCAAGGACGGCGGGACGCAGGGACTTTTTGGCAGCTTTCATGAGAAAGCGCACGAGGTGGAGCAGAGTATTCACCGGACATTGCGG
ATTGGAACGCGCGTGGAGACGAGTGCTTTGTATAGTCGTTTGGAAGCTCAGGGGTACAATCCTAATGCCATTCAGCGAGCTATTCGAGCGATGGTACAGA
AGGGAGCTCTGCGACAATTGAGCCAGTATAAGTTTGTATCGCGCGTCAAGTAG