Transcript Name :
Hyaar_Emoy2801741
Orientation:
(-)
Number of Exons:
1
Description :
protein kinase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
DEP domain11.898PS50186
Protein kinase domain48.88PS50011
AGC-kinase, C-terminal14.417PS51285
HmmSmart predictionP-Valprediction_id
DEP domain2.6SM00049
Serine/threonine- / dual specificity protein kinase, catalytic domain5.7SM00220
AGC-kinase, C-terminal4.3SM00133
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-702
*** None ***
*** None ***
TypeScore
cytoplasmic391
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein serine/threonine kinase activityGO:0004674IEA
protein phosphorylationGO:0006468IEA
*** None ***
Cluster Id
4509
Sequence
        2109 bases(100 bases per row)
ATGTCGTCCAGCAAAACGCGTATCAAGGCCAAACGGCGCTATTTACTTAAAGTGACGCCAATTGAAGCGTGGGACCTGCTGCCCACCGAGTCCATTCGAG
GTCGGAATTCCTACTGTACGCTCGTGCTGCTGGACGAACACAAGCGGGAGATCAAGGGCGAGAAGCAGCGCACGCCTGCTATGCGACAAGCGAATCCCGT
GTGGAGTCCGCTAAAAGCTGCGGTCCTGCGGTCCTTAGAGAGCAACGTCGAGTCCCATCAGCCACTGGGAATTGGGGCAGCAGCGGCGTCGGAAGAGTAC
ACTTTTGGGATCCAGACGAATCTGGTGAACGCCAAGTACGTGCTGGTAAAGTGCAAAGACAAGGGACGCGTCGAGAGCGAGGATTTGGGACGATTGTTGC
TGAGTTTAGAAGACATGAACACCAGTGGTGAAGAGCGGGTGGCGTGGTACGACTTGCAATTGCGTCCCGGTGGTAAAATGAAGCGCGTGCAGGGCAAAGT
ACGGATTTCGAGTCGCATTGTGCGCGAGCCGAGTTTGTGGCAGCTGTGGACGTGTGCGGAGCAGATGAGGCAGGAGTTGCATGCACGGGATCGTAGTTTG
TACTTGAAACCACATCCGAATGTGATCACGGGCAAAGAGGCATTGGAGTGGATGCTGTGTCATGGACTGAACCGTCCCATGCGTGGAGGCGTGACGTGCT
CGACTGCTGAAGAAGCTTTGTTACTTGGTACAGCGCTTATTCGTAATGGGATCATGATGCACGTGTCAGGAGATCGGCGATTCACCAATAGCACGTGGAA
GTACTATCGTTTTATGGTAAATCATTTAGACGCAGCTGTGCAGACGGAAGCTGTTCGACAGCGTGATATGATCCTTTCGGGTGAAGCAGAAGAAGTGGAA
GACACGGAAGAGGAGGTGTTGACTCGTTCTATGATGGCCACGTCCGTGTGCAATGAGGAGGAACATGGATTAGGTGCGTCGCAAGTGCACGACGATGTTA
CTGGCGGTTCAAACGCGACAGGATCGGCACAGGCTGGAGACTCTGATAAAGGCAAATCCAAGTCAACGATCAAGATTGAAGATTTTCAGCTGCTCAAGGT
ACTTGGCACTGGAACGTATGGTCGTGTGTTGTCTGCACGTGGCCCTGATGGAAATGTCTACGCCATCAAGATCATCACGAAGATTGGCATGGACGAGAAC
ATGCGTCGTAACGCAAAGATTGAGCGGGATATGCTGCGTGAAGTTCGCCATCCGTTTGTGGCGTCGCTGCTGTTTGCTTTCCAGAACGAAGATAAGGTGT
ACATGGGTATGGAGTTTTATAATGGTGGCGACTTGCGCCATCACTTGACGATGAACCAGAGTGACGAGCTGAAGCTTACGCCTGGACGCATTGTATTTTA
CGCAGCAGAGTTGGTGGCGGGCCTGGCACATCTGCACAGTCTCGACATCATCTATCGTGATCTCAAGCCAGAGAATGTTCTTATCCAAAAAGATGGTCAC
ATCGTGCTTGTGGACTTTGGCCTTTCAACGTATGCAAAGGAGGGGGATGACAAGAAAGCACACTCACTCGCTGGCTCGCCAGAGTACATTTCGCCTGAGG
TTCTCGCTGCCGCAACCCCCAAGAAGGGCGAAGCTCTTGCCGTGTACGACACAACGTGCGACTGGTGGAGCCTTGGCATCCTTATCTTTGAAATGTACGT
TGGACGTACACCTTTCAAAGACGACAACACTGCTATTATGTACCGCAATATTGCCGAAGGGTTTTTGTACATTCCGCCCGAATTACCTGAAGACGTCCGG
TCACTACTTGCCGGTTTGATTGAGCGAGATCCGTCAAGGCGGCTAGGAGCCAATGAGGCTGTGCCGTTTTCAATTATGATGCACCCGTTCTTCAGTGGCA
TTGACTGGGAAGCTCTGCAGCAGAAGAAGGTGCAGCCAGAGTGGGTACCTGACGTCATCGATGATGCTGACGCCAAGTACATCGACAATGAGTTCATTAA
CCAGGTACCAGTGGATACACCCGAGTGGCGCATGCTCGATTCAGTGGACCGCGAGCAGGAGTACTTTGCAGACTTTACGTATCGCGCGACGAAAGTTATT
CAGAAGTGA