Transcript Name :
Phyke_g2199
Orientation:
(-)
Number of Exons:
2
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-114
166-260
135-143
115-134
144-165
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        866 bases(100 bases per row)
ATGCTGCTCTACCGTGGTCCTCGTGGCGCTGTGCGCCTCGCCACGGCGTTCTCTGCTTCGTGTCGATCCATCAGCTCGACCCCTCAGATTGTCAAGCGTT
CTGTCCACGTGTCGGTGTTGCAGCAACTCCCATCGACTTTCTACAGTCGCCGCAATGCCGCATCGACCGAAAACTTTATCGGTCGACGATGGAGCTCCAA
TGTTAGCGCTCCTCAAACCGATGACGACGTCCAGAAGAAGCATGAGGAGGAAACGGAGCGTATTTTACAACAAGTTGACGCTGTGGAAGGTGAACCTGTT
TATCAGGGACCTATGGCACGCGCCGTTCGCATTATGAAGGGCGTGTCCGTGACCAGCTGCATCCTCACGTCCATCGGCATGCCAGTGCTCTGTGTAGTGA
GCGAGCAGGACGCCTCCATGATCGGCAAGGTGAGCAACAATATAATTATAAAGACGGGATGTGAGGGGAGCGATATGGAGTATTGAACTCTGTGAACTGA
TGTCTTTTGTAGTGGGCCATGTGCAGCACTGTGATGCTCTTCGGATTGGGAACGACGTCGCTCTTCCACTACCTGTTCAAGCCGTATGTGATCCGTATGT
GGATTGCAAACTCTGAGGCTGAAGATGGGGCTCCAGTATCTGCTGCCACGGGGGCATCAGTCACAGACGATTCGATGGTTACCGTGGAGACAATGTCGCT
CTTTGCTCGGCCCCAGAAGCATTCGTTCCTACTGTCGGAGGTGTCTCCCCCCAAACAGCACCCCATGGTGTCGTTCCAGGCGCGTGACCGCCAATACTTC
ATTCACCCGGAGGAATTCAAGGATATTGCcttgctgaagaagttcatgcCTGGTTGGAAAAAATAA