Transcript Name :
Phyke_g2197
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_358438
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-201
NN-scoreoddsWeighted Score
0.5721.2680.003
*** None ***
TypeScore
cytoplasmic478
GO
*** None ***
KO ID
K01094
*** None ***
Sequence
        880 bases(100 bases per row)
ATGAAGGGACTCAACCTGGGCGGCGTGGTGGAATTCTGCCGCGTGCTGACGCACCAACCGCAGCTTCTACTGCCGCATATCTCCGTCAAAGGTATAGTTC
TTGGTGTCTTCTATCCGGCTATCCAGAAATTTCATTGATATGACATCTACAGCCTGCACAATTTACAAACTAAAACCCTATGCTCCTCTTTTAGATGTGA
CGGAAATCCCCTTCCAAAAGCTCCAAGACCGCGGGTTTCGTGCCGTTATCTTCGACAAGGATAACACACTCACAGTACCCCATCGACTGGAGATTGCACC
TCATTTAGCGGGTTCTCTGGCCGAATGTCGCCGTGTTTTCGGCGATACTGGCgttgtcatcttctccaaCTCGGCAGGCTCCACAGATGACAAGGACGGC
GTAGAGGCCAAGCGCATTGAAGACGAGCTTCAGGTACCTGTCCTTCGACACAATCAAAAGGTACTGGGGGAGCGTTGGTTGCGATATTGGGTGGAGCTTG
GGGCTCTGACAGGCGTATGTGTTTGTTGCAGAAACCTGGAGGTGCCgcgttcgtgaagaagcactTCGGTGATGTAGATCCAGCCACGCTTATCATAATT
GGTGATCGGTACTCGACAGATGTGCTGTTTGGCAACCTTAACGGTACGGTGGTAATTCATTGAATCGATCATGAATGTGTGTTGTGACGCGTCTTTGATC
TTTGGTGTTTGTACAGGATTATTGACAATTCGAACGGAGCAATTTACACCTGAGAGTGAGAGTTTGGTGAATAGACAGCTGCAACGCATCGAAAAGGCAG
CCGTTCAAATGCTTCAACGTGCAGGTGTTAAACCGTTAACGCATCCGCTTTGGGAAAATGAAGACAGTGAGGACGCATGA