Transcript Name :
Hyaar_Emoy2800029
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-427
NN-scoreoddsWeighted Score
0.6391.7340.003
*** None ***
TypeScore
mitochondrial478
GO
*** None ***
*** None ***
Cluster Id
3952
Sequence
        1284 bases(100 bases per row)
ATGGTGAGTGGTGGCAAAGTGCCTCGACGCAACGGACGGACCCGTCGTCTCCAGGGCTCAGGCGCTCTATTGCAGTGCGGTACAGGATCTTTCCATCCAA
GCTCTCGTCTGCTGGTGTGGCACTCGTGCTTTTCACACGCTGCGTCTCGCCACGAGAGCGTCGTGCGTGGCCACGCTCTCAACCAGCAGCTCGAAGTGTA
TCTTCCATCCAAAGCTGGGCGAGCTACTGCGCAGTCTTTACAATGGGAAACTGGCTTTTATTATGAGGTGAAAACATCCGTGACGATGTTTCTGTTGCCT
GCTTTCATCCGCACGTACCTTATGGACGGCGGTGCAGTGTTTATGGTGGCCAAGAACGTGGCAGTGGACGCGTCGCAGTCTGCGATGCTGCTGCCTTCCG
GTCACTTGCTGCTGCTAGTGGATGCTGATACGTACCATCAATTGGGGATCGTGGGGGGGAAATATGGCAAGGCAGCACCTGCAAGTAGCAGGACAGCACA
TGAAAAGCAGGGACAGAAGTACGTGATTACGTTGGACTTGACGTCGTTAATGTTTCTTGCTGAAGAAGGGAATCATCATCACTTGGGAGAGCGCGTGCGG
AGGTTGTTGAGCACGAAACTTGATCATCTGGAGATGTTGCTGTGCGCATACAATCAGCGTGGCTCGCCACGCACGATCTTGTTTGGAGAAGATGACACCG
TGCCACGGGTACGAGTTGAGCTGAATGGCAAGACCACGACGTTTAACGACGTGTTTCTGCCCAAGTTTGATGCTTTTTACAAGGCGTTGAGTGCGAGTGA
CGAGCACGGAGATGGTCGAATGGACACGTTGAGAACGTCGTTGCACGAGGCGTATGACTGGTTGGGGCTCGTAGCCTGCCGATTGACAAACTTGTTGCAG
AGAGAAAAGCTGGAAGAGTATGTGTCGACGTTCGCAGGAATTCCTGATTCATTTGAATGTGAACCGGACGGTGAGATCACGACGGTGCAGTGGCGCGGTC
TACTAGCCGCGCCGTTTTGTTCAGCAATTGCTGAAAAGGTGCAGCTTGCTGTCAAGAATGGGGATTTGCCGTGGGGTGCAGTTACAGTGTGGGGTTTTCC
GGATGTCTTTGTGTCGTGGGTGCAGCAGACCAAGCTGAACAAAAGTACTAAGGGAACGAACGGGTCTCAGCGACGAGAGCATGGCTACCTGGGTAATGGT
AGCAACAACTACACAATACTCATGCTTCCAAACGAGGAGTACTTTGTGCTGCAATCTCTCGGCCCACATGATGCCACCATGTAG