Transcript Name :
Hyaar_Emoy2800014
Orientation:
(+)
Number of Exons:
1
Description :
glutathione S-transferase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Glutathione S-transferase, N-terminal24.707PS50404
Glutathione S-transferase, C-terminal-like11.346PS50405
Glutathione S-transferase, N-terminal23.136PS50404
Glutathione S-transferase, C-terminal-like19.117PS50405
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Glutathione S-transferase, C-terminal-likeIPR010987
*** None ***
InsideOutsideTMhelix
1-416
NN-scoreoddsWeighted Score
0.5261.1260.002
*** None ***
TypeScore
cytoplasmic522
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1251 bases(100 bases per row)
ATGAGCACCTTCCCCTCGATCAAACTTACGTACTTTTCTGCTGCTGGCCGTGCCGAGGCCGCACGTCTAATTTTCTACATCGGGGGCATCCCTTTTGAAG
ACAAGCGCATCACCCGTGAGCAGTTCATGGCCATGAAGGACACATTCCCGTTAGGCCAAGTGCCCACGCTCGAGATCAATGGCGATGTAATGACCCAATC
GTACGCTATGATGCGGTACGCTGGCCGCTTGAGCGGACTGTATCCCTCCACGAGACCCGTGCTGGCTCTAAAGATCGACGAGGTACTGAGTGTGATGGGC
GAGATTGAAGCCAGGATGGTGCCATCGTTCTATGAGTCGGACGTGGCCAAGAAAAAAGCCATGCGAGAAGAGCTGACGACCGTCACGCTCCCTCGCTACG
CTGGACTCTTGGAGGCTTGTCTGCAGAAAATGAAGCAGACGCCATTTTTCCAGTCGGACCGCATCTATGTGCACGAAGTAGCCATCTACATTTGGGTCAA
ATCGCTCCGGTCTGGCGTCATCGACTTTATCCCTACGACGGTGTTGAGTAGCTACCAGTTGCTCAACGAGATGCACGACAAGGTTGCGAACCACCCGAAA
GTCCAAGAGTGGTACCGGCTCGAGCACAATGCACCCAAGCTGAAGCTCACGTACTTTCCCGCACAAGGTCGTGGCGAGCCAATCCGTCTGGCCTTTTATA
TCGGAGACGTTGAGTTTGAAGACGAGCGCGTCCCACTCGAAGAGATGTTGGCGCGCAAGCCGTCGCTGCCGTTCAACCAGTTCCCAGTGCTAGAAGTGAA
CGGTGAGGTGATGTCGCAGGCGCTGGCAATCCTTCGCTATGCTGGCACCATGTCGGGACTGTACCCCGTGACTGACCCGATTGCTGCTTATCGGATCGAC
GAGCTGCTATCAATCATGGACGATATGTTTAACAACCCGCTATGGGGTGCCTCGCACCGTGAGAAGAACATGGAGAAGAAGGAAGAACTGCGCGCTGAAC
TGTCGACTGTCGTGCCCAAGACACTAGGTTTCTTGGAGAAGCGCATTGCTAAGAACAAGGGACCCTACGCGGCTGGCCCGAACCTCTCTGTGGTAGACCT
TGCAATCTACTCTGCCCTGATGGACTTTACGATGAACTTGCCGAAACTCATGAGCACCGTGCAAGACTCGTATCCAAACGTGTACCGCGTGTACGACCAG
GTACTGAAGCACCCGAAGGTCGTGGAATGGAACGCAGCGCACAACCAGTAA